RchiOBHm_Chr3g0453891

Protein of unknown function (DUF679)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
4185154 .. 4185477
324 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
ATGTCTACTGAAAAACCCGAAACGCTCGCACCAGCACACATTCCAAAGACTATATCCAGCACAGCCAATCTTGCCAACCTCCTACCTACCGGCACCGTCCTCGCATTCCAGACCCTCATCCCTAGCTTCTCTAGCAACGGATCATGTCATCCTTCCAATAAGGACCTTACGATATCCATCATTGTAATCTGTGCCCTCTTATGCTTCTTCTCTTCTTTTACTGATAGCTTCATAGACAGTACCGATGGACAATTCTATTATGGTATTGTCACTAGTGAAGGCATGTATATCTTAAACTCCACGTCAGAAGATACAAAACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.51

Weight (kDa)

4.55

Isoelectric Point (pI)

52.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF679 PF05078 19 - 104 2.1e-31 Protein of unknown function (DUF679)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 92
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 1 cut(s) 148
AfaI GTAC 1 cut(s) 241
AhlI ACTAGT 1 cut(s) 272
AjiI CACGTC 1 cut(s) 303
AluBI AGCT 2 cut(s) 126, 228
AluI AGCT 2 cut(s) 126, 228
AlwI GGATC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 163
AvaII GGWCC 1 cut(s) 163
BaeGI GKGCMC 1 cut(s) 196
BanI GGYRCC 1 cut(s) 92
BccI CCATC 2 cut(s) 185, 239
BcgI CGANNNNNNTGC 2 cut(s) 82, 116
BcuI ACTAGT 1 cut(s) 272
BfaI CTAG 3 cut(s) 123, 132, 273
Bme18I GGWCC 1 cut(s) 163
BmgBI CACGTC 1 cut(s) 303
BmgT120I GGNCC 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 176
Bse118I RCCGGY 1 cut(s) 89
Bse8I GATNNNNATC 1 cut(s) 176
BseGI GGATG 2 cut(s) 117, 148
BseJI GATNNNNATC 1 cut(s) 176
BseSI GKGCMC 1 cut(s) 196
BshNI GGYRCC 1 cut(s) 92
BsiSI CCGG 1 cut(s) 90
BsmI GAATGC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 196
Bsp143I GATC 1 cut(s) 140
BspLI GGNNCC 1 cut(s) 94
BspPI GGATC 1 cut(s) 148
BspT107I GGYRCC 1 cut(s) 92
BsrFI RCCGGY 1 cut(s) 89
BssAI RCCGGY 1 cut(s) 89
BssMI GATC 1 cut(s) 140
Bst4CI ACNGT 3 cut(s) 97, 239, 321
Bst6I CTCTTC 1 cut(s) 217
BstC8I GCNNGC 1 cut(s) 27
BstF5I GGATG 2 cut(s) 117, 148
BstKTI GATC 1 cut(s) 143
BstMBI GATC 1 cut(s) 140
BstMWI GCNNNNNNNGC 2 cut(s) 71, 132
BstNSI RCATGY 1 cut(s) 286
BstSLI GKGCMC 1 cut(s) 196
BtrI CACGTC 1 cut(s) 303
BtsCI GGATG 2 cut(s) 117, 148
Cac8I GCNNGC 1 cut(s) 27
Cfr10I RCCGGY 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 163
Csp6I GTAC 1 cut(s) 240
CviAII CATG 2 cut(s) 144, 283
CviJI RGCY 3 cut(s) 65, 126, 228
CviKI_1 RGCY 3 cut(s) 65, 126, 228
CviQI GTAC 1 cut(s) 240
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Eco32I GATATC 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 163
EcoO109I RGGNCCY 1 cut(s) 163
EcoRV GATATC 1 cut(s) 174
FaeI CATG 2 cut(s) 147, 286
FaiI YATR 7 cut(s) 53, 145, 202, 233, 261, 284, 288
FatI CATG 2 cut(s) 143, 282
FblI GTMKAC 1 cut(s) 5
FokI GGATG 2 cut(s) 104, 135
FspBI CTAG 3 cut(s) 123, 132, 273
HapII CCGG 1 cut(s) 90
Hin1II CATG 2 cut(s) 147, 286
HpaII CCGG 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 307
Hpy188III TCNNGA 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 2 cut(s) 162, 272
HpyCH4III ACNGT 3 cut(s) 97, 239, 321
HpyCH4IV ACGT 1 cut(s) 302
HpyF10VI GCNNNNNNNGC 2 cut(s) 71, 132
HpySE526I ACGT 1 cut(s) 302
Hsp92II CATG 2 cut(s) 147, 286
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 4 cut(s) 45, 70, 103, 122
MaeI CTAG 3 cut(s) 123, 132, 273
MaeII ACGT 1 cut(s) 302
MaeIII GTNAC 1 cut(s) 268
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 3 cut(s) 199, 204, 320
MhlI GDGCHC 1 cut(s) 196
MluCI AATT 1 cut(s) 251
MnlI CCTC 4 cut(s) 89, 110, 125, 206
MseI TTAA 1 cut(s) 293
MspI CCGG 1 cut(s) 90
Mva1269I GAATGC 1 cut(s) 104
MwoI GCNNNNNNNGC 2 cut(s) 71, 132
NdeII GATC 1 cut(s) 140
NlaIII CATG 2 cut(s) 147, 286
NlaIV GGNNCC 1 cut(s) 94
NmuCI GTSAC 1 cut(s) 268
NspI RCATGY 1 cut(s) 286
PctI GAATGC 1 cut(s) 104
PpuMI RGGWCCY 1 cut(s) 163
Psp5II RGGWCCY 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 1 cut(s) 163
PspPPI RGGWCCY 1 cut(s) 163
RsaI GTAC 1 cut(s) 241
RsaNI GTAC 1 cut(s) 240
SaqAI TTAA 1 cut(s) 293
Sau3AI GATC 1 cut(s) 140
Sau96I GGNCC 1 cut(s) 163
SduI GDGCHC 1 cut(s) 196
SetI ASST 6 cut(s) 81, 88, 128, 168, 230, 305
SinI GGWCC 1 cut(s) 163
SpeI ACTAGT 1 cut(s) 272
Sse9I AATT 1 cut(s) 251
SspMI CTAG 3 cut(s) 123, 132, 273
TaaI ACNGT 3 cut(s) 97, 239, 321
TaiI ACGT 1 cut(s) 305
TasI AATT 1 cut(s) 251
Tru1I TTAA 1 cut(s) 293
Tru9I TTAA 1 cut(s) 293
TseFI GTSAC 1 cut(s) 268
Tsp45I GTSAC 1 cut(s) 268
TspDTI ATGAA 1 cut(s) 220
TspGWI ACGGA 1 cut(s) 153
VpaK11BI GGWCC 1 cut(s) 163
XceI RCATGY 1 cut(s) 286
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 3 cut(s) 123, 132, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.