Rmu_sc0003556.1_g000024

Protein of unknown function (DUF679)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003556.1
OG0001834
Physical Location & Seq
Forward (+)
103200 .. 103892
693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003556.1_g000024.1.cds

Sequence Viewer

Length: 693 bp
atgtctactgaaaaacccgaaacgctcgcaccagcacccattccaaagaccatatccagcacagccaatcttgccaacctcctacctaccggcaccgtcctcgcattccagaccctcatccctagcttctctaataacggatcatgccatccttccaataagggccttacgatatccatcattgtaatctgcgcccttttatgcttcttctcttcttttactgatagcttcatagacagtaccgatggaaaattctattatggtattgccactagtgaaggtatgtatatcttaaactccacgtcagaagatactaaacaacgaaggcgtcgcttgaaagggtataggagaatgcctgtagatcattttcacgcccttatgtcactaactctgttcttgatctatgctttaaccaacctcaacgtgaaagattgtttctttcccaaagcaggagataatctttctcaagtcattatcaatttgccattaggagctgggattttggcatgcttcttattcactatttttccaactactagaagaggaattggattcaccctgcttcgtccggaaaaggtaaaagaagccgagggccaagcctcgaccaccacgaccacaccccaaggattaaccccgaaaaaggaggttgtagttgaaataggagccgatgcccagcccttggccacaacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF679

Protein Analysis

230

Amino Acids

25.01

Weight (kDa)

8.81

Isoelectric Point (pI)

50.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 92
AccB7I CCANNNNNTGG 1 cut(s) 679
AccI GTMKAC 1 cut(s) 5
AccIII TCCGGA 1 cut(s) 568
AclWI GGATC 1 cut(s) 148
AcoI YGGCCR 1 cut(s) 681
AcsI RAATTY 1 cut(s) 251
AcyI GRCGYC 1 cut(s) 328
AfaI GTAC 1 cut(s) 241
AfiI CCNNNNNNNGG 3 cut(s) 449, 640, 679
AgsI TTSAA 2 cut(s) 337, 656
AhlI ACTAGT 1 cut(s) 272
AjiI CACGTC 1 cut(s) 303
AluBI AGCT 3 cut(s) 126, 228, 494
AluI AGCT 3 cut(s) 126, 228, 494
AlwI GGATC 1 cut(s) 148
Aor13HI TCCGGA 1 cut(s) 568
AoxI GGCC 3 cut(s) 163, 592, 681
ApoI RAATTY 1 cut(s) 251
AspLEI GCGC 1 cut(s) 194
AspS9I GGNCC 2 cut(s) 163, 592
AsuHPI GGTGA 1 cut(s) 547
BalI TGGCCA 1 cut(s) 683
BanI GGYRCC 1 cut(s) 92
BccI CCATC 3 cut(s) 156, 185, 239
BcgI CGANNNNNNTGC 2 cut(s) 82, 116
BcuI ACTAGT 1 cut(s) 272
BfaI CTAG 4 cut(s) 123, 273, 537, 691
BfmI CTRYAG 1 cut(s) 357
BmgBI CACGTC 1 cut(s) 303
BmgT120I GGNCC 2 cut(s) 163, 592
BmiI GGNNCC 2 cut(s) 94, 664
BmsI GCATC 1 cut(s) 658
BpuEI CTTGAG 1 cut(s) 450
BsaBI GATNNNNATC 1 cut(s) 176
BsaHI GRCGYC 1 cut(s) 328
BsaJI CCNNGG 3 cut(s) 588, 622, 678
BsaWI WCCGGW 1 cut(s) 568
Bsc4I CCNNNNNNNGG 3 cut(s) 449, 640, 679
Bse118I RCCGGY 1 cut(s) 89
Bse8I GATNNNNATC 1 cut(s) 176
BseAI TCCGGA 1 cut(s) 568
BseDI CCNNGG 3 cut(s) 588, 622, 678
BseGI GGATG 2 cut(s) 117, 148
BseJI GATNNNNATC 1 cut(s) 176
BseLI CCNNNNNNNGG 3 cut(s) 449, 640, 679
BseYI CCCAGC 2 cut(s) 494, 672
BshFI GGCC 3 cut(s) 165, 594, 683
BshNI GGYRCC 1 cut(s) 92
BsiSI CCGG 2 cut(s) 90, 569
BslI CCNNNNNNNGG 3 cut(s) 449, 640, 679
BsmI GAATGC 2 cut(s) 104, 357
BsnI GGCC 3 cut(s) 165, 594, 683
Bsp13I TCCGGA 1 cut(s) 568
Bsp143I GATC 3 cut(s) 140, 361, 399
BspANI GGCC 3 cut(s) 165, 594, 683
BspEI TCCGGA 1 cut(s) 568
BspLI GGNNCC 2 cut(s) 94, 664
BspPI GGATC 1 cut(s) 148
BspT107I GGYRCC 1 cut(s) 92
BsrFI RCCGGY 1 cut(s) 89
BssAI RCCGGY 1 cut(s) 89
BssECI CCNNGG 3 cut(s) 588, 622, 678
BssMI GATC 3 cut(s) 140, 361, 399
BssNI GRCGYC 1 cut(s) 328
BssT1I CCWWGG 2 cut(s) 622, 678
Bst4CI ACNGT 2 cut(s) 97, 239
Bst6I CTCTTC 2 cut(s) 217, 535
BstACI GRCGYC 1 cut(s) 328
BstC8I GCNNGC 2 cut(s) 27, 508
BstF5I GGATG 2 cut(s) 117, 148
BstHHI GCGC 1 cut(s) 194
BstKTI GATC 3 cut(s) 143, 364, 402
BstMBI GATC 3 cut(s) 140, 361, 399
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstNSI RCATGY 1 cut(s) 510
BstSFI CTRYAG 1 cut(s) 357
BsuRI GGCC 3 cut(s) 165, 594, 683
BtrI CACGTC 1 cut(s) 303
BtsCI GGATG 2 cut(s) 117, 148
Cac8I GCNNGC 2 cut(s) 27, 508
CfoI GCGC 1 cut(s) 194
Cfr10I RCCGGY 1 cut(s) 89
Cfr13I GGNCC 2 cut(s) 163, 592
CseI GACGC 1 cut(s) 317
Csp6I GTAC 1 cut(s) 240
CviAII CATG 2 cut(s) 144, 507
CviQI GTAC 1 cut(s) 240
DpnI GATC 3 cut(s) 142, 363, 401
DpnII GATC 3 cut(s) 140, 361, 399
EaeI YGGCCR 1 cut(s) 681
Eam1104I CTCTTC 2 cut(s) 217, 535
EarI CTCTTC 2 cut(s) 217, 535
Eco130I CCWWGG 2 cut(s) 622, 678
Eco32I GATATC 1 cut(s) 174
EcoO109I RGGNCCY 1 cut(s) 163
EcoRV GATATC 1 cut(s) 174
EcoT14I CCWWGG 2 cut(s) 622, 678
ErhI CCWWGG 2 cut(s) 622, 678
FaeI CATG 2 cut(s) 147, 510
FatI CATG 2 cut(s) 143, 506
FblI GTMKAC 1 cut(s) 5
FokI GGATG 2 cut(s) 104, 135
FspBI CTAG 4 cut(s) 123, 273, 537, 691
GlaI GCGC 1 cut(s) 193
GsaI CCCAGC 2 cut(s) 498, 676
HaeIII GGCC 3 cut(s) 165, 594, 683
HapII CCGG 2 cut(s) 90, 569
HgaI GACGC 1 cut(s) 317
HhaI GCGC 1 cut(s) 194
Hin1I GRCGYC 1 cut(s) 328
Hin1II CATG 2 cut(s) 147, 510
Hin6I GCGC 1 cut(s) 192
HinP1I GCGC 1 cut(s) 192
HinfI GANTC 1 cut(s) 552
HpaII CCGG 2 cut(s) 90, 569
HphI GGTGA 1 cut(s) 547
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 307
Hpy188III TCNNGA 3 cut(s) 109, 397, 569
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 333
HpyAV CCTTC 3 cut(s) 162, 272, 318
HpyCH4III ACNGT 2 cut(s) 97, 239
HpyCH4IV ACGT 2 cut(s) 302, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpySE526I ACGT 2 cut(s) 302, 423
Hsp92I GRCGYC 1 cut(s) 328
Hsp92II CATG 2 cut(s) 147, 510
HspAI GCGC 1 cut(s) 192
Kpn2I TCCGGA 1 cut(s) 568
Kzo9I GATC 3 cut(s) 140, 361, 399
LmnI GCTCC 2 cut(s) 491, 662
LweI GCATC 1 cut(s) 658
MaeI CTAG 4 cut(s) 123, 273, 537, 691
MaeII ACGT 2 cut(s) 302, 423
MaeIII GTNAC 1 cut(s) 381
MalI GATC 3 cut(s) 142, 363, 401
MboI GATC 3 cut(s) 140, 361, 399
MboII GAAGA 4 cut(s) 199, 204, 320, 552
MlsI TGGCCA 1 cut(s) 683
MluCI AATT 3 cut(s) 251, 478, 546
MluNI TGGCCA 1 cut(s) 683
MmeI TCCRAC 1 cut(s) 554
MnlI CCTC 8 cut(s) 89, 110, 125, 428, 536, 583, 610, 637
Mox20I TGGCCA 1 cut(s) 683
MroI TCCGGA 1 cut(s) 568
MscI TGGCCA 1 cut(s) 683
MseI TTAA 3 cut(s) 293, 410, 629
Msp20I TGGCCA 1 cut(s) 683
MspI CCGG 2 cut(s) 90, 569
Mva1269I GAATGC 2 cut(s) 104, 357
MwoI GCNNNNNNNGC 1 cut(s) 71
NdeII GATC 3 cut(s) 140, 361, 399
NlaIII CATG 2 cut(s) 147, 510
NlaIV GGNNCC 2 cut(s) 94, 664
NmeAIII GCCGAG 1 cut(s) 613
NmuCI GTSAC 1 cut(s) 381
NspI RCATGY 1 cut(s) 510
PaeI GCATGC 1 cut(s) 510
PcsI WCGNNNNNNNCGW 1 cut(s) 608
PctI GAATGC 2 cut(s) 104, 357
PfeI GAWTC 1 cut(s) 552
PflMI CCANNNNNTGG 1 cut(s) 679
PspFI CCCAGC 2 cut(s) 494, 672
PspN4I GGNNCC 2 cut(s) 94, 664
PspPI GGNCC 2 cut(s) 163, 592
RsaI GTAC 1 cut(s) 241
RsaNI GTAC 1 cut(s) 240
SaqAI TTAA 3 cut(s) 293, 410, 629
Sau3AI GATC 3 cut(s) 140, 361, 399
Sau96I GGNCC 2 cut(s) 163, 592
SfaNI GCATC 1 cut(s) 658
SfcI CTRYAG 1 cut(s) 357
SmlI CTYRAG 1 cut(s) 465
SmoI CTYRAG 1 cut(s) 465
SpeI ACTAGT 1 cut(s) 272
SphI GCATGC 1 cut(s) 510
Sse9I AATT 3 cut(s) 251, 478, 546
SspMI CTAG 4 cut(s) 123, 273, 537, 691
StyI CCWWGG 2 cut(s) 622, 678
TaaI ACNGT 2 cut(s) 97, 239
TaiI ACGT 2 cut(s) 305, 426
TaqI TCGA 1 cut(s) 602
TasI AATT 3 cut(s) 251, 478, 546
TfiI GAWTC 1 cut(s) 552
Tru1I TTAA 3 cut(s) 293, 410, 629
Tru9I TTAA 3 cut(s) 293, 410, 629
TseFI GTSAC 1 cut(s) 381
Tsp45I GTSAC 1 cut(s) 381
TspDTI ATGAA 1 cut(s) 220
TspGWI ACGGA 1 cut(s) 153
Van91I CCANNNNNTGG 1 cut(s) 679
XapI RAATTY 1 cut(s) 251
XceI RCATGY 1 cut(s) 510
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 4 cut(s) 123, 273, 537, 691
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.