RchiOBHm_Chr3g0453901

Protein of unknown function (DUF679)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0001834
Physical Location & Seq
Forward (+)
4185512 .. 4185733
222 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42096

Sequence Viewer

Length: 222 bp
ATGCCTGTAGATCATTTTCACGCCTTTATGTCACTAACTCTGTTCTTGATCTATGCTTTAACCAACCTCAACGTGAAAGATTGTTTCTTTCCCGAAGCAGGAGATAATCTTTCTCAAGTCATTATCAATTTGCCATTAGGAGCTGGGATTTTCGCATGCTTATTATTCACTATTTTTCCAACTACAAGAAGAGGAATTGGATTCACCCTCCGGAAAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF679

Protein Analysis

73

Amino Acids

8.22

Weight (kDa)

8.84

Isoelectric Point (pI)

52.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF679 PF05078 3 - 68 8.8e-20 Protein of unknown function (DUF679)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 210
AfiI CCNNNNNNNGG 1 cut(s) 98
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Aor13HI TCCGGA 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 196
BfmI CTRYAG 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 99
BsaWI WCCGGW 1 cut(s) 210
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseAI TCCGGA 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 98
BseYI CCCAGC 1 cut(s) 143
BsiSI CCGG 1 cut(s) 211
BslI CCNNNNNNNGG 1 cut(s) 98
Bsp13I TCCGGA 1 cut(s) 210
Bsp143I GATC 2 cut(s) 10, 48
BspEI TCCGGA 1 cut(s) 210
BssMI GATC 2 cut(s) 10, 48
Bst6I CTCTTC 1 cut(s) 184
BstC8I GCNNGC 1 cut(s) 157
BstKTI GATC 2 cut(s) 13, 51
BstMBI GATC 2 cut(s) 10, 48
BstNSI RCATGY 1 cut(s) 159
BstSFI CTRYAG 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 157
CviAII CATG 1 cut(s) 156
CviJI RGCY 1 cut(s) 143
CviKI_1 RGCY 1 cut(s) 143
DpnI GATC 2 cut(s) 12, 50
DpnII GATC 2 cut(s) 10, 48
Eam1104I CTCTTC 1 cut(s) 184
EarI CTCTTC 1 cut(s) 184
FaeI CATG 1 cut(s) 159
FaiI YATR 3 cut(s) 29, 54, 157
FatI CATG 1 cut(s) 155
GsaI CCCAGC 1 cut(s) 147
HapII CCGG 1 cut(s) 211
Hin1II CATG 1 cut(s) 159
HinfI GANTC 1 cut(s) 201
HpaII CCGG 1 cut(s) 211
HphI GGTGA 1 cut(s) 196
Hpy188III TCNNGA 3 cut(s) 46, 92, 211
HpyCH4IV ACGT 1 cut(s) 72
HpySE526I ACGT 1 cut(s) 72
Hsp92II CATG 1 cut(s) 159
Kpn2I TCCGGA 1 cut(s) 210
Kzo9I GATC 2 cut(s) 10, 48
LmnI GCTCC 1 cut(s) 140
LpnPI CCDG 3 cut(s) 18, 84, 129
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 30
MalI GATC 2 cut(s) 12, 50
MboI GATC 2 cut(s) 10, 48
MboII GAAGA 1 cut(s) 201
MluCI AATT 2 cut(s) 127, 195
MmeI TCCRAC 1 cut(s) 203
MnlI CCTC 3 cut(s) 77, 185, 218
MroI TCCGGA 1 cut(s) 210
MseI TTAA 1 cut(s) 59
MspI CCGG 1 cut(s) 211
NdeII GATC 2 cut(s) 10, 48
NlaIII CATG 1 cut(s) 159
NmuCI GTSAC 1 cut(s) 30
NspI RCATGY 1 cut(s) 159
PaeI GCATGC 1 cut(s) 159
PfeI GAWTC 1 cut(s) 201
PspFI CCCAGC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 59
Sau3AI GATC 2 cut(s) 10, 48
SetI ASST 4 cut(s) 69, 75, 145, 221
SfcI CTRYAG 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
SphI GCATGC 1 cut(s) 159
Sse9I AATT 2 cut(s) 127, 195
TaiI ACGT 1 cut(s) 75
TasI AATT 2 cut(s) 127, 195
TfiI GAWTC 1 cut(s) 201
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
TseFI GTSAC 1 cut(s) 30
Tsp45I GTSAC 1 cut(s) 30
XceI RCATGY 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.