RchiOBHm_Chr3g0479611

Nuclear pore complex protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
25417828 .. 25419648
1821 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 759 bp
ATGTTAGAGAAAATTGGACATGAATGGCTACTTAAAACATATGCTGATGTTAGGTTTGTCAGCAAGGATGGAAAGTATCTTGCTCTGGGAAGCAAAGACGGAGATATATGTGTGGTTAACGTTAAGAAAATGGAGCATGAATTGGTTGAGCTCCGACATCACATTTCATCTCAAGGTGTTGTGAACTCGCTTGAACAGGTTGCTTTGACATGCATGGGAAAGTTTCGAGATGAAATATTTTTATTCCCTGGTGGCTTTAGTTCTGATAATCAGGCATGTCTTGATATTATCATGGCAAAACAATTACCAAAGACAGCCTGTCATTCAATCTTCTTTAAGCTCATATTGGCAATTCTTAGACAAGAATCATCAGATGCTTTAAGGAGAGGGCAATATGCCCTACTGCTTAACTATTTTCGCTATTTTCAACACAAGCTTGATCTAGATATCCCATCAGCAGTTCTGCAATTTTTGTTACTTGAATCTTTCAAGCATGTTGTAAAAGGTTGGTTGAGGTATTCTTCTAACCATCCAATTGTTTTACTGACTTCTATTGCTACAGCATTGTTAAGTTTAAAGGTTTGGGTACTTAACTCGCATGGTTTAATTAGGCTCAAGGCTAAAGTGTTATTTGGTGGTGCATTCTTGATAAGAGAGGTCATGTTTGTTAATGAATGCCACATTGTTCACACTAGAGCAATTGATAAAAGACTTGTTTGCCATTTGGGTGGAGAGTTGCACGTTACCATCTCATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

252

Amino Acids

28.66

Weight (kDa)

9.09

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 120
AfaI GTAC 1 cut(s) 588
AgsI TTSAA 5 cut(s) 194, 327, 428, 482, 490
AhdI GACNNNNNGTC 1 cut(s) 318
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 3 cut(s) 151, 340, 436
AluI AGCT 3 cut(s) 151, 340, 436
Alw21I GWGCWC 1 cut(s) 153
BanII GRGCYC 1 cut(s) 153
Bbv12I GWGCWC 1 cut(s) 153
BccI CCATC 4 cut(s) 62, 460, 537, 755
BciT130I CCWGG 1 cut(s) 249
BfaI CTAG 2 cut(s) 443, 693
BfmI CTRYAG 1 cut(s) 558
Bme1390I CCNGG 1 cut(s) 249
BmeRI GACNNNNNGTC 1 cut(s) 318
BmrFI CCNGG 1 cut(s) 249
BmsI GCATC 1 cut(s) 364
BpuEI CTTGAG 2 cut(s) 156, 599
BsaJI CCNNGG 1 cut(s) 247
BseBI CCWGG 1 cut(s) 249
BseDI CCNNGG 1 cut(s) 247
BseGI GGATG 2 cut(s) 73, 529
BsiHKAI GWGCWC 1 cut(s) 153
BsmI GAATGC 2 cut(s) 641, 680
Bsp1286I GDGCHC 1 cut(s) 153
Bsp143I GATC 1 cut(s) 439
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 1 cut(s) 439
Bst2UI CCWGG 1 cut(s) 249
BstDEI CTNAG 1 cut(s) 356
BstF5I GGATG 2 cut(s) 73, 529
BstKTI GATC 1 cut(s) 442
BstMBI GATC 1 cut(s) 439
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 3 cut(s) 213, 279, 497
BstSCI CCNGG 1 cut(s) 247
BstSFI CTRYAG 1 cut(s) 558
BstXI CCANNNNNNTGG 1 cut(s) 728
BtsCI GGATG 2 cut(s) 73, 529
Csp6I GTAC 1 cut(s) 587
CviAII CATG 9 cut(s) 20, 137, 210, 214, 276, 292, 494, 599, 661
CviJI RGCY 8 cut(s) 28, 151, 255, 317, 340, 436, 613, 620
CviKI_1 RGCY 8 cut(s) 28, 151, 255, 317, 340, 436, 613, 620
CviQI GTAC 1 cut(s) 587
DdeI CTNAG 1 cut(s) 356
DpnI GATC 1 cut(s) 441
DpnII GATC 1 cut(s) 439
DraI TTTAAA 1 cut(s) 576
DriI GACNNNNNGTC 1 cut(s) 318
Eam1105I GACNNNNNGTC 1 cut(s) 318
Ecl136II GAGCTC 1 cut(s) 151
Eco24I GRGCYC 1 cut(s) 153
Eco32I GATATC 1 cut(s) 448
Eco53kI GAGCTC 1 cut(s) 151
EcoICRI GAGCTC 1 cut(s) 151
EcoRII CCWGG 1 cut(s) 247
EcoRV GATATC 1 cut(s) 448
EcoT22I ATGCAT 1 cut(s) 215
EcoT38I GRGCYC 1 cut(s) 153
FaeI CATG 9 cut(s) 23, 140, 213, 217, 279, 295, 497, 602, 664
FatI CATG 9 cut(s) 19, 136, 209, 213, 275, 291, 493, 598, 660
FauNDI CATATG 1 cut(s) 40
FokI GGATG 2 cut(s) 80, 516
FriOI GRGCYC 1 cut(s) 153
FspBI CTAG 2 cut(s) 443, 693
Hin1II CATG 9 cut(s) 23, 140, 213, 217, 279, 295, 497, 602, 664
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HindIII AAGCTT 1 cut(s) 434
HinfI GANTC 2 cut(s) 365, 482
HpaI GTTAAC 1 cut(s) 118
Hpy166II GTNNAC 3 cut(s) 118, 184, 688
Hpy188I TCNGA 3 cut(s) 155, 265, 373
Hpy188III TCNNGA 4 cut(s) 227, 281, 443, 646
Hpy8I GTNNAC 3 cut(s) 118, 184, 688
HpyCH4IV ACGT 2 cut(s) 120, 741
HpyCH4V TGCA 4 cut(s) 213, 466, 641, 739
HpyF3I CTNAG 1 cut(s) 356
HpySE526I ACGT 2 cut(s) 120, 741
Hsp92II CATG 9 cut(s) 23, 140, 213, 217, 279, 295, 497, 602, 664
KspAI GTTAAC 1 cut(s) 118
Kzo9I GATC 1 cut(s) 439
LmnI GCTCC 2 cut(s) 133, 156
LpnPI CCDG 6 cut(s) 71, 182, 234, 257, 261, 331
LweI GCATC 1 cut(s) 364
MaeI CTAG 2 cut(s) 443, 693
MaeII ACGT 2 cut(s) 120, 741
MaeIII GTNAC 2 cut(s) 474, 742
MalI GATC 1 cut(s) 441
MboI GATC 1 cut(s) 439
MboII GAAGA 2 cut(s) 322, 513
MfeI CAATTG 2 cut(s) 534, 699
MhlI GDGCHC 1 cut(s) 153
MluCI AATT 8 cut(s) 12, 140, 302, 351, 467, 534, 606, 699
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 3 cut(s) 380, 507, 649
Mph1103I ATGCAT 1 cut(s) 215
MslI CAYNNNNRTG 1 cut(s) 726
MspR9I CCNGG 1 cut(s) 249
MunI CAATTG 2 cut(s) 534, 699
Mva1269I GAATGC 2 cut(s) 641, 680
MvaI CCWGG 1 cut(s) 249
NdeI CATATG 1 cut(s) 40
NdeII GATC 1 cut(s) 439
NlaIII CATG 9 cut(s) 23, 140, 213, 217, 279, 295, 497, 602, 664
NsiI ATGCAT 1 cut(s) 215
NspI RCATGY 3 cut(s) 213, 279, 497
PctI GAATGC 2 cut(s) 641, 680
PfeI GAWTC 2 cut(s) 365, 482
Psp124BI GAGCTC 1 cut(s) 153
Psp1406I AACGTT 1 cut(s) 120
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
RsaI GTAC 1 cut(s) 588
RsaNI GTAC 1 cut(s) 587
RseI CAYNNNNRTG 1 cut(s) 726
SacI GAGCTC 1 cut(s) 153
Sau3AI GATC 1 cut(s) 439
ScrFI CCNGG 1 cut(s) 249
SduI GDGCHC 1 cut(s) 153
SfaNI GCATC 1 cut(s) 364
SfcI CTRYAG 1 cut(s) 558
SmiMI CAYNNNNRTG 1 cut(s) 726
SmlI CTYRAG 2 cut(s) 171, 614
SmoI CTYRAG 2 cut(s) 171, 614
Sse9I AATT 8 cut(s) 12, 140, 302, 351, 467, 534, 606, 699
SspI AATATT 1 cut(s) 237
SspMI CTAG 2 cut(s) 443, 693
SstI GAGCTC 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 247
TaiI ACGT 2 cut(s) 123, 744
TaqI TCGA 1 cut(s) 226
TasI AATT 8 cut(s) 12, 140, 302, 351, 467, 534, 606, 699
TfiI GAWTC 2 cut(s) 365, 482
TspDTI ATGAA 5 cut(s) 36, 153, 156, 246, 687
TspGWI ACGGA 1 cut(s) 114
XbaI TCTAGA 1 cut(s) 442
XceI RCATGY 3 cut(s) 213, 279, 497
XspI CTAG 2 cut(s) 443, 693
Zsp2I ATGCAT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.