Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0032285.1

Orthogroup ID

OG0003682

Physical Location & Seq

Genomic Coordinates Reverse (-)

33 .. 500

Gene Structure 468 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0032285.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 468 bp

atgccttctagttattcttctgttacaagtcaggaaggacagcaccatatggaaagagtgctgactaggttaaatgttcctgcagattggaagaagtggcagatctatttgttgcttgtaggaatgtttttggcttttgcagttgcattttatatcttttttgagaagtctggtaatccttggaacttccctcttgaaaaatatcaaccagcaagacctgaattctgggaaattcaaaagttatgtttgcttcatagcttttgctattaccatatcaatgcaccaagacatgagttgggagctgatgtgatatcttcagatttttctcttcttaatgtggatgacctcgcagatcagtttgttgcactggttgacttcttgggtttgaaaaaagtattgagcttgggtggtgacttcactgacttgcatgatggagtagggacaatttggaagataattcaggcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002790 GO:0003400 GO:0003674 GO:0005085 GO:0005090 GO:0005096 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0005886 GO:0006810 GO:0006811 GO:0006817 GO:0006820 GO:0006888 GO:0006950 GO:0007154 GO:0008047 GO:0008104 GO:0008150 GO:0009267 GO:0009306 GO:0009605 GO:0009987 GO:0009991 GO:0012505 GO:0015031 GO:0015698 GO:0015833 GO:0016020 GO:0016021 GO:0016036 GO:0016192 GO:0019899 GO:0030176 GO:0030234 GO:0030695 GO:0031224 GO:0031227 GO:0031667 GO:0031668 GO:0031669 GO:0031984 GO:0032386 GO:0032879 GO:0032940 GO:0033036 GO:0033043 GO:0033554 GO:0042175 GO:0042594 GO:0042886 GO:0043085 GO:0043087 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043254 GO:0043547 GO:0044087 GO:0044093 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0046903 GO:0046907 GO:0048193 GO:0048209 GO:0050789 GO:0050790 GO:0050794 GO:0050896 GO:0051020 GO:0051049 GO:0051128 GO:0051179 GO:0051234 GO:0051336 GO:0051345 GO:0051641 GO:0051649 GO:0051716 GO:0060341 GO:0060589 GO:0060627 GO:0060628 GO:0065007 GO:0065009 GO:0071496 GO:0071702 GO:0071705 GO:0071944 GO:0090113 GO:0098772 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko04141 map04141

Pfam Domains

Protein Families

WD40

Protein Analysis

155

Amino Acids

17.81

Weight (kDa)

5.59

Isoelectric Point (pI)

29.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003682)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g12421 FvH4_3g20453 FvH4_3g20454
malus_domestica	MD16G1253500.v1.1
rosa_chinensis	RchiOBHm_Chr3g0479611 RchiOBHm_Chr4g0393431 RchiOBHm_Chr4g0403131 RchiOBHm_Chr4g0403161 RchiOBHm_Chr4g0419441 RchiOBHm_Chr5g0007271 RchiOBHm_Chr5g0056401
rosa_multiflora	Rmu_sc0000577.1_g000014 Rmu_sc0001218.1_g000016 Rmu_sc0001787.1_g000002 Rmu_sc0001877.1_g000005 Rmu_sc0002396.1_g000007 Rmu_sc0002522.1_g000025 Rmu_sc0002699.1_g000023 Rmu_sc0002822.1_g000015 Rmu_sc0002822.1_g000017 Rmu_sc0003347.1_g000019 Rmu_sc0004174.1_g000005 Rmu_sc0004874.1_g000013 Rmu_sc0009422.1_g000002 Rmu_sc0017595.1_g000001 Rmu_sc0032285.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033040 Rroxscaffold_2G00106480 Rroxscaffold_3G00267930 Rroxscaffold_4G00326640 Rroxscaffold_5G00382820 Rroxscaffold_6G00403290 Rroxscaffold_7G00191420
rosa_samantha	Rh2AG247000 Rh6CG057200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	221, 231
AcuI	CTGAAG	1 cut(s)	300
AgsI	TTSAA	3 cut(s)	197, 236, 388
AluBI	AGCT	3 cut(s)	258, 302, 402
AluI	AGCT	3 cut(s)	258, 302, 402
ApoI	RAATTY	2 cut(s)	221, 231
AsuHPI	GGTGA	1 cut(s)	422
BccI	CCATC	1 cut(s)	425
BfaI	CTAG	2 cut(s)	9, 66
BfmI	CTRYAG	1 cut(s)	81
BglII	AGATCT	1 cut(s)	102
BsaJI	CCNNGG	1 cut(s)	179
BsaXI	ACNNNNNCTCC	2 cut(s)	291, 321
Bse1I	ACTGG	1 cut(s)	372
BseDI	CCNNGG	1 cut(s)	179
BseGI	GGATG	1 cut(s)	346
BseNI	ACTGG	1 cut(s)	372
BslFI	GGGAC	1 cut(s)	454
BsmFI	GGGAC	1 cut(s)	454
Bsp143I	GATC	2 cut(s)	102, 352
BspMAI	CTGCAG	1 cut(s)	85
BsrI	ACTGG	1 cut(s)	372
BssECI	CCNNGG	1 cut(s)	179
BssMI	GATC	2 cut(s)	102, 352
BssT1I	CCWWGG	1 cut(s)	179
Bst6I	CTCTTC	1 cut(s)	333
BstF5I	GGATG	1 cut(s)	346
BstKTI	GATC	2 cut(s)	105, 355
BstMBI	GATC	2 cut(s)	102, 352
BstSFI	CTRYAG	1 cut(s)	81
BstX2I	RGATCY	1 cut(s)	102
BstYI	RGATCY	1 cut(s)	102
BtsCI	GGATG	1 cut(s)	346
BtsIMutI	CAGTG	2 cut(s)	365, 417
CviAII	CATG	2 cut(s)	290, 428
CviJI	RGCY	5 cut(s)	134, 258, 302, 402, 464
CviKI_1	RGCY	5 cut(s)	134, 258, 302, 402, 464
DpnI	GATC	2 cut(s)	104, 354
DpnII	GATC	2 cut(s)	102, 352
Eam1104I	CTCTTC	1 cut(s)	333
EarI	CTCTTC	1 cut(s)	333
Eco130I	CCWWGG	1 cut(s)	179
Eco32I	GATATC	1 cut(s)	312
Eco57I	CTGAAG	1 cut(s)	300
EcoRI	GAATTC	1 cut(s)	221
EcoRV	GATATC	1 cut(s)	312
EcoT14I	CCWWGG	1 cut(s)	179
ErhI	CCWWGG	1 cut(s)	179
FaeI	CATG	2 cut(s)	293, 431
FaiI	YATR	8 cut(s)	48, 50, 153, 244, 255, 273, 291, 429
FaqI	GGGAC	1 cut(s)	454
FatI	CATG	2 cut(s)	289, 427
FauNDI	CATATG	1 cut(s)	48
FokI	GGATG	1 cut(s)	353
FspBI	CTAG	2 cut(s)	9, 66
Hin1II	CATG	2 cut(s)	293, 431
HincII	GTYRAC	1 cut(s)	373
HindII	GTYRAC	1 cut(s)	373
HphI	GGTGA	1 cut(s)	422
Hpy166II	GTNNAC	1 cut(s)	373
Hpy188I	TCNGA	1 cut(s)	319
Hpy188III	TCNNGA	2 cut(s)	32, 194
Hpy8I	GTNNAC	1 cut(s)	373
HpyAV	CCTTC	2 cut(s)	15, 29
HpyCH4V	TGCA	6 cut(s)	83, 140, 146, 281, 365, 427
Hsp92II	CATG	2 cut(s)	293, 431
Kzo9I	GATC	2 cut(s)	102, 352
LmnI	GCTCC	1 cut(s)	299
LpnPI	CCDG	8 cut(s)	17, 93, 156, 211, 222, 231, 353, 446
MaeI	CTAG	2 cut(s)	9, 66
MaeIII	GTNAC	2 cut(s)	22, 410
MalI	GATC	2 cut(s)	104, 354
MboI	GATC	2 cut(s)	102, 352
MboII	GAAGA	5 cut(s)	9, 103, 306, 320, 463
MflI	RGATCY	1 cut(s)	102
MluCI	AATT	4 cut(s)	221, 231, 444, 456
MnlI	CCTC	2 cut(s)	201, 356
MseI	TTAA	2 cut(s)	71, 333
MslI	CAYNNNNRTG	1 cut(s)	276
NdeI	CATATG	1 cut(s)	48
NdeII	GATC	2 cut(s)	102, 352
NlaIII	CATG	2 cut(s)	293, 431
NmuCI	GTSAC	1 cut(s)	410
PstI	CTGCAG	1 cut(s)	85
PsuI	RGATCY	1 cut(s)	102
RseI	CAYNNNNRTG	1 cut(s)	276
SaqAI	TTAA	2 cut(s)	71, 333
Sau3AI	GATC	2 cut(s)	102, 352
SetI	ASST	6 cut(s)	71, 220, 260, 304, 348, 404
SfcI	CTRYAG	1 cut(s)	81
SmiMI	CAYNNNNRTG	1 cut(s)	276
Sse9I	AATT	4 cut(s)	221, 231, 444, 456
SspMI	CTAG	2 cut(s)	9, 66
StyI	CCWWGG	1 cut(s)	179
TasI	AATT	4 cut(s)	221, 231, 444, 456
Tru1I	TTAA	2 cut(s)	71, 333
Tru9I	TTAA	2 cut(s)	71, 333
TscAI	CASTG	2 cut(s)	372, 424
TseFI	GTSAC	1 cut(s)	410
Tsp45I	GTSAC	1 cut(s)	410
TspDTI	ATGAA	1 cut(s)	242
TspRI	CASTG	2 cut(s)	372, 424
XapI	RAATTY	2 cut(s)	221, 231
XspI	CTAG	2 cut(s)	9, 66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.