RchiOBHm_Chr4g0419441

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
44850234 .. 44850879
646 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38935

Sequence Viewer

Length: 189 bp
ATGGCAGTTCTGCTCAAACTATTGGTACATACACTGGTTTCTCTCTCTATTCGCATTCGTATACACCACAGCAATACTACCCACCATCACCGCCATCACAATCGTTCACCCAAAATCCTCAATTTCACACTCAGATTAGTAGTATGGTCGATTCCACCCACTCCTTTTCCCCAATCCATTCTCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.24

Weight (kDa)

12.0

Isoelectric Point (pI)

54.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 61
AciI CCGC 1 cut(s) 91
AfaI GTAC 1 cut(s) 27
AsuHPI GGTGA 2 cut(s) 80, 99
BccI CCATC 2 cut(s) 93, 102
Bse1I ACTGG 1 cut(s) 39
BseMII CTCAG 1 cut(s) 145
BseNI ACTGG 1 cut(s) 39
BsmI GAATGC 1 cut(s) 54
BspACI CCGC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 144
BsrI ACTGG 1 cut(s) 39
BssNAI GTATAC 1 cut(s) 62
Bst1107I GTATAC 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 131
BstZ17I GTATAC 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 32
Csp6I GTAC 1 cut(s) 26
CviQI GTAC 1 cut(s) 26
DdeI CTNAG 1 cut(s) 131
FaiI YATR 5 cut(s) 30, 62, 145, 185, 187
FauNDI CATATG 1 cut(s) 185
FblI GTMKAC 1 cut(s) 61
HinfI GANTC 1 cut(s) 151
HphI GGTGA 2 cut(s) 80, 99
Hpy166II GTNNAC 2 cut(s) 62, 107
Hpy188I TCNGA 1 cut(s) 134
Hpy8I GTNNAC 2 cut(s) 62, 107
HpyF3I CTNAG 1 cut(s) 131
LpnPI CCDG 1 cut(s) 20
MluCI AATT 1 cut(s) 121
MnlI CCTC 1 cut(s) 128
Mva1269I GAATGC 1 cut(s) 54
NdeI CATATG 1 cut(s) 185
PctI GAATGC 1 cut(s) 54
PfeI GAWTC 1 cut(s) 151
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
SgeI CNNG 1 cut(s) 47
Sse9I AATT 1 cut(s) 121
SsiI CCGC 1 cut(s) 91
TaqI TCGA 1 cut(s) 149
TasI AATT 1 cut(s) 121
TfiI GAWTC 1 cut(s) 151
TscAI CASTG 1 cut(s) 39
TspRI CASTG 1 cut(s) 39
XmiI GTMKAC 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.