RchiOBHm_Chr3g0481391

Casein Kinase 2 substrate

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
27474174 .. 27474675
502 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 309 bp
ATGGAAGTGATGGTGAAGAAATACCAGCATAGGTTCAGGAATGTGAGGGACGAGATGGATTGTTGGGACAAGCTTCAAGTTCTCTTAGTTTCTCAGTTCAGAAACGCCTCCACCATCATCCAGAGGTTGCAGGTTCTTCAAGATTCCAAAAACTATGGTGGCTTGAATGAACTTGTTGATATTCAAGAGGTGGTCTTGGTGAAGCAGATGGAGTCTTTGCAAAAACTCTTGCTTTCCATGAAAAATACCATGTACTTTCCTTTTGTTTCTTCCTTCTTTCATTTCATTCGATTTCACATTTTTACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

12.31

Weight (kDa)

9.21

Isoelectric Point (pI)

43.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CA109-like PF15011 7 - 84 7.7e-21 Ribosome biogenesis protein C1orf109-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 121
AfaI GTAC 1 cut(s) 254
AgsI TTSAA 4 cut(s) 77, 140, 166, 185
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
AsuHPI GGTGA 2 cut(s) 25, 211
BccI CCATC 4 cut(s) 4, 49, 122, 202
BfuAI ACCTGC 1 cut(s) 121
BseGI GGATG 1 cut(s) 117
BseMII CTCAG 1 cut(s) 107
BslFI GGGAC 2 cut(s) 62, 80
BsmFI GGGAC 2 cut(s) 62, 80
BspCNI CTCAG 1 cut(s) 106
BspMI ACCTGC 1 cut(s) 121
BstDEI CTNAG 2 cut(s) 85, 93
BstF5I GGATG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 117
BveI ACCTGC 1 cut(s) 121
Csp6I GTAC 1 cut(s) 253
CviAII CATG 2 cut(s) 238, 250
CviJI RGCY 2 cut(s) 73, 162
CviKI_1 RGCY 2 cut(s) 73, 162
CviQI GTAC 1 cut(s) 253
DdeI CTNAG 2 cut(s) 85, 93
FaeI CATG 2 cut(s) 241, 253
FaiI YATR 4 cut(s) 30, 156, 239, 251
FaqI GGGAC 2 cut(s) 62, 80
FatI CATG 2 cut(s) 237, 249
FokI GGATG 1 cut(s) 104
Hin1II CATG 2 cut(s) 241, 253
HindIII AAGCTT 1 cut(s) 71
HinfI GANTC 2 cut(s) 143, 212
HphI GGTGA 2 cut(s) 25, 211
Hpy188I TCNGA 1 cut(s) 101
Hpy188III TCNNGA 4 cut(s) 37, 121, 140, 185
HpyAV CCTTC 1 cut(s) 283
HpyCH4V TGCA 2 cut(s) 130, 220
HpyF3I CTNAG 2 cut(s) 85, 93
Hsp92II CATG 2 cut(s) 241, 253
LpnPI CCDG 4 cut(s) 22, 38, 116, 134
MboII GAAGA 3 cut(s) 28, 128, 261
MlyI GAGTC 1 cut(s) 221
MnlI CCTC 4 cut(s) 39, 117, 118, 181
MseI TTAA 1 cut(s) 307
NlaIII CATG 2 cut(s) 241, 253
PfeI GAWTC 1 cut(s) 143
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
RsaI GTAC 1 cut(s) 254
RsaNI GTAC 1 cut(s) 253
SaqAI TTAA 1 cut(s) 307
SchI GAGTC 1 cut(s) 221
SetI ASST 5 cut(s) 35, 75, 128, 135, 192
TaqI TCGA 1 cut(s) 289
TatI WGTACW 1 cut(s) 252
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 1 cut(s) 307
Tru9I TTAA 1 cut(s) 307
TspDTI ATGAA 4 cut(s) 183, 254, 269, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.