RchiOBHm_Chr3g0481381

Casein Kinase 2 substrate

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0002014
Physical Location & Seq
Reverse (-)
27471094 .. 27474172
3079 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44635

Sequence Viewer

Length: 267 bp
ATGTCTCTTGGGAGGATTCATCGTGATGGTAGGCACATGATAAAAGGTGGTTCTAGTCAGCTGAGTACAAAACAACTACAGCAGCGAGTTGGTGTAAAACCCACTCTTGCAGATTGCTTAGATGGGCTTATGCTTCTCCAGGACATGCATTGCTCTGATACCAGTGATTTGAGTTCGCTGCAGCAAATCTTGATTGACCAGCCTAACATTCCCAGGGAAGAAGTTCAATTTGTCTTTGATATCATATTTGCACAAGAGAATTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CK2S

Protein Analysis

88

Amino Acids

9.9

Weight (kDa)

5.4

Isoelectric Point (pI)

63.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CA109-like PF15011 2 - 59 2.1e-12 Ribosome biogenesis protein C1orf109-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 67
AgsI TTSAA 1 cut(s) 227
AjnI CCWGG 2 cut(s) 138, 212
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
Alw26I GTCTC 1 cut(s) 9
ApeKI GCWGC 3 cut(s) 82, 178, 181
Asp700I GAANNNNTTC 1 cut(s) 222
BbvI GCAGC 3 cut(s) 94, 165, 193
BccI CCATC 2 cut(s) 20, 116
BciT130I CCWGG 2 cut(s) 140, 214
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 1 cut(s) 54
BfmI CTRYAG 2 cut(s) 77, 179
BisI GCNGC 3 cut(s) 83, 179, 182
BlsI GCNGC 3 cut(s) 84, 180, 183
Bme1390I CCNGG 2 cut(s) 140, 214
BmrFI CCNGG 2 cut(s) 140, 214
BpmI CTGGAG 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 212, 213
Bse1I ACTGG 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 148
BseBI CCWGG 2 cut(s) 140, 214
BseDI CCNNGG 2 cut(s) 212, 213
BseMI GCAATG 1 cut(s) 148
BseMII CTCAG 1 cut(s) 53
BseNI ACTGG 1 cut(s) 162
BseXI GCAGC 3 cut(s) 94, 165, 193
BsmAI GTCTC 1 cut(s) 9
BspCNI CTCAG 1 cut(s) 54
BspMAI CTGCAG 1 cut(s) 183
BsrDI GCAATG 1 cut(s) 148
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 2 cut(s) 212, 213
Bst2UI CCWGG 2 cut(s) 140, 214
BstDEI CTNAG 2 cut(s) 62, 118
BstMAI GTCTC 1 cut(s) 9
BstNI CCWGG 2 cut(s) 140, 214
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 2 cut(s) 138, 212
BstSFI CTRYAG 2 cut(s) 77, 179
BstV1I GCAGC 3 cut(s) 94, 165, 193
BtsIMutI CAGTG 1 cut(s) 169
Csp6I GTAC 1 cut(s) 66
CviAII CATG 2 cut(s) 37, 145
CviJI RGCY 3 cut(s) 61, 127, 202
CviKI_1 RGCY 3 cut(s) 61, 127, 202
CviQI GTAC 1 cut(s) 66
DdeI CTNAG 2 cut(s) 62, 118
Eco32I GATATC 1 cut(s) 241
EcoRII CCWGG 2 cut(s) 138, 212
EcoRV GATATC 1 cut(s) 241
EcoT22I ATGCAT 1 cut(s) 150
FaeI CATG 2 cut(s) 40, 148
FaiI YATR 4 cut(s) 38, 131, 146, 245
FatI CATG 2 cut(s) 36, 144
Fnu4HI GCNGC 3 cut(s) 83, 179, 182
Fsp4HI GCNGC 3 cut(s) 83, 179, 182
FspBI CTAG 1 cut(s) 54
GluI GCNGC 3 cut(s) 83, 179, 182
GsuI CTGGAG 1 cut(s) 122
Hin1II CATG 2 cut(s) 40, 148
HinfI GANTC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 157
Hpy188III TCNNGA 2 cut(s) 23, 190
HpyCH4V TGCA 4 cut(s) 110, 148, 181, 251
HpyF3I CTNAG 2 cut(s) 62, 118
Hsp92II CATG 2 cut(s) 40, 148
LpnPI CCDG 6 cut(s) 125, 152, 175, 199, 212, 226
Lsp1109I GCAGC 3 cut(s) 94, 165, 193
MaeI CTAG 1 cut(s) 54
MboII GAAGA 1 cut(s) 230
MluCI AATT 2 cut(s) 227, 259
MnlI CCTC 1 cut(s) 6
Mph1103I ATGCAT 1 cut(s) 150
MroXI GAANNNNTTC 1 cut(s) 222
MslI CAYNNNNRTG 1 cut(s) 24
MspA1I CMGCKG 1 cut(s) 61
MspR9I CCNGG 2 cut(s) 140, 214
MvaI CCWGG 2 cut(s) 140, 214
NlaIII CATG 2 cut(s) 40, 148
NsiI ATGCAT 1 cut(s) 150
NspI RCATGY 1 cut(s) 148
PasI CCCWGGG 1 cut(s) 213
PdmI GAANNNNTTC 1 cut(s) 222
PfeI GAWTC 1 cut(s) 16
PfoI TCCNGGA 1 cut(s) 138
PkrI GCNGC 3 cut(s) 84, 180, 183
Psp6I CCWGG 2 cut(s) 138, 212
PspGI CCWGG 2 cut(s) 138, 212
PstI CTGCAG 1 cut(s) 183
PvuII CAGCTG 1 cut(s) 61
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
RseI CAYNNNNRTG 1 cut(s) 24
SatI GCNGC 3 cut(s) 83, 179, 182
ScrFI CCNGG 2 cut(s) 140, 214
SetI ASST 2 cut(s) 49, 63
SfcI CTRYAG 2 cut(s) 77, 179
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 2 cut(s) 227, 259
SspMI CTAG 1 cut(s) 54
StyD4I CCNGG 2 cut(s) 138, 212
TasI AATT 2 cut(s) 227, 259
TatI WGTACW 1 cut(s) 65
TfiI GAWTC 1 cut(s) 16
TscAI CASTG 1 cut(s) 169
TseI GCWGC 3 cut(s) 82, 178, 181
TspDTI ATGAA 1 cut(s) 8
TspRI CASTG 1 cut(s) 169
XceI RCATGY 1 cut(s) 148
XmnI GAANNNNTTC 1 cut(s) 222
XspI CTAG 1 cut(s) 54
Zsp2I ATGCAT 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.