RLG00000023401

Casein Kinase 2 substrate

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
23097609 .. 23100702
3094 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000023401

Sequence Viewer

Length: 315 bp
ATGCATCTGAGTAGAAATTTTTTTTGGCTCAATCTGCTGCACCTAAACAATAAGAGAGAACTGCCACCTCAATCTGGTCTGAAAAGACTAAGTTTGAGTATTGGAATCTGTGCCTTTGTTGTTGGGTTGGCAGATGCGATGGAAGTGATGGTGAAGAAATACCAGCATAGGTTCAGGAATGTGAGGGACGAGATGGATTGTTGGGACAAGCTTCAAGTTCTTTTAGTTTCTCAGTTCAGAAACGCCTCCACCATCATCCAGAGGTTCCAGGTCTCTCAGTTTCTCTCCAATTATTATATACCTTTTTCTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.36

Weight (kDa)

9.83

Isoelectric Point (pI)

42.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CA109-like PF15011 53 - 99 1.2e-08 Ribosome biogenesis protein C1orf109-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 215
AjnI CCWGG 1 cut(s) 267
AjuI GAANNNNNNNTTGG 2 cut(s) 7, 39
AluBI AGCT 1 cut(s) 211
AluI AGCT 1 cut(s) 211
Alw26I GTCTC 1 cut(s) 277
ApeKI GCWGC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 163
BbvI GCAGC 1 cut(s) 24
BccI CCATC 4 cut(s) 133, 142, 187, 260
BciT130I CCWGG 1 cut(s) 269
BcoDI GTCTC 1 cut(s) 277
BfaI CTAG 1 cut(s) 313
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 269
BmiI GGNNCC 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 269
BmsI GCATC 2 cut(s) 13, 124
BsaI GGTCTC 1 cut(s) 277
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseBI CCWGG 1 cut(s) 269
BseGI GGATG 1 cut(s) 255
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMII CTCAG 2 cut(s) 245, 290
BseXI GCAGC 1 cut(s) 24
BsgI GTGCAG 1 cut(s) 23
BslFI GGGAC 2 cut(s) 200, 218
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 277
BsmFI GGGAC 2 cut(s) 200, 218
Bso31I GGTCTC 1 cut(s) 277
BspCNI CTCAG 2 cut(s) 244, 289
BspLI GGNNCC 1 cut(s) 266
BspTNI GGTCTC 1 cut(s) 277
Bst2UI CCWGG 1 cut(s) 269
BstDEI CTNAG 4 cut(s) 8, 89, 231, 276
BstF5I GGATG 1 cut(s) 255
BstMAI GTCTC 1 cut(s) 277
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNI CCWGG 1 cut(s) 269
BstSCI CCNGG 1 cut(s) 267
BstV1I GCAGC 1 cut(s) 24
BtgZI GCGATG 1 cut(s) 152
BtsCI GGATG 1 cut(s) 255
CviJI RGCY 2 cut(s) 28, 211
CviKI_1 RGCY 2 cut(s) 28, 211
DdeI CTNAG 4 cut(s) 8, 89, 231, 276
Eco31I GGTCTC 1 cut(s) 277
EcoRII CCWGG 1 cut(s) 267
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 3 cut(s) 168, 297, 299
FaqI GGGAC 2 cut(s) 200, 218
Fnu4HI GCNGC 1 cut(s) 38
FokI GGATG 1 cut(s) 242
Fsp4HI GCNGC 1 cut(s) 38
FspBI CTAG 1 cut(s) 313
GluI GCNGC 1 cut(s) 38
HindIII AAGCTT 1 cut(s) 209
HinfI GANTC 1 cut(s) 105
HphI GGTGA 1 cut(s) 163
Hpy188I TCNGA 3 cut(s) 9, 81, 239
Hpy188III TCNNGA 2 cut(s) 175, 259
HpyCH4V TGCA 2 cut(s) 4, 40
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 4 cut(s) 8, 89, 231, 276
LpnPI CCDG 6 cut(s) 60, 160, 176, 254, 272, 281
Lsp1109I GCAGC 1 cut(s) 24
LweI GCATC 2 cut(s) 13, 124
MaeI CTAG 1 cut(s) 313
MboII GAAGA 1 cut(s) 166
MluCI AATT 2 cut(s) 16, 289
MnlI CCTC 4 cut(s) 78, 177, 255, 256
Mph1103I ATGCAT 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 269
MvaI CCWGG 1 cut(s) 269
MwoI GCNNNNNNNGC 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 266
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 105
PkrI GCNGC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 267
PspGI CCWGG 1 cut(s) 267
PspN4I GGNNCC 1 cut(s) 266
SatI GCNGC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 269
SetI ASST 7 cut(s) 45, 70, 173, 213, 266, 273, 304
SfaNI GCATC 2 cut(s) 13, 124
SgeI CNNG 9 cut(s) 87, 175, 187, 202, 220, 227, 271, 280, 281
Sse9I AATT 2 cut(s) 16, 289
SspMI CTAG 1 cut(s) 313
StyD4I CCNGG 1 cut(s) 267
TasI AATT 2 cut(s) 16, 289
TfiI GAWTC 1 cut(s) 105
TseI GCWGC 1 cut(s) 37
XapI RAATTY 1 cut(s) 16
XspI CTAG 1 cut(s) 313
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.