RchiOBHm_Chr2g0134611

dnaJ homolog subfamily A member 2-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
51748112 .. 51752552
4441 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGAGAACAGAGCAGACACCTATTGGCTTGTTTTCTCAGGAGAAACAGTTTCTGCATGTCTGGATTGTGGTGGAGATGGTGAAGGTATTTCTGAATACTGTCGGAAGTGCTGGAGAAGGACGTGTTCATGTTAAGATAAGTATCAAAGTGCAAATTCCTCCTCGTGTTAGCAGGGGAAGTATTCTTAGAGTTGCTGGAGAGGGAGGTGCTGGACCGAGAGGGGGTCCTCCTGGGGATCTTTATGTATATCTTGATGTTGAAGAAGTAGAAGGAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

9.98

Weight (kDa)

6.73

Isoelectric Point (pI)

20.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ_C PF01556 41 - 88 1.7e-09 DnaJ C terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 243
AcsI RAATTY 2 cut(s) 153, 273
AfiI CCNNNNNNNGG 1 cut(s) 221
AflIII ACRYGT 1 cut(s) 121
AgsI TTSAA 1 cut(s) 260
AjiI CACGTC 1 cut(s) 122
AjnI CCWGG 1 cut(s) 229
AlwI GGATC 1 cut(s) 243
AlwNI CAGNNNCTG 1 cut(s) 52
ApoI RAATTY 2 cut(s) 153, 273
AspS9I GGNCC 2 cut(s) 212, 224
AsuHPI GGTGA 1 cut(s) 91
AvaII GGWCC 2 cut(s) 212, 224
BauI CACGAG 1 cut(s) 162
BccI CCATC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 231
Bme1390I CCNGG 1 cut(s) 231
Bme18I GGWCC 2 cut(s) 212, 224
BmgBI CACGTC 1 cut(s) 122
BmgT120I GGNCC 2 cut(s) 212, 224
BmiI GGNNCC 1 cut(s) 225
BmrFI CCNGG 1 cut(s) 231
BpmI CTGGAG 2 cut(s) 132, 216
BsaBI GATNNNNATC 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 230
BsaXI ACNNNNNCTCC 2 cut(s) 32, 62
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse8I GATNNNNATC 1 cut(s) 140
BseBI CCWGG 1 cut(s) 231
BseDI CCNNGG 1 cut(s) 230
BseJI GATNNNNATC 1 cut(s) 140
BseLI CCNNNNNNNGG 1 cut(s) 221
BseMII CTCAG 1 cut(s) 50
BseRI GAGGAG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 221
Bsp143I GATC 1 cut(s) 235
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 225
BspPI GGATC 1 cut(s) 243
BssECI CCNNGG 1 cut(s) 230
BssMI GATC 1 cut(s) 235
BssSI CACGAG 1 cut(s) 162
Bst2BI CACGAG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 231
Bst4CI ACNGT 2 cut(s) 48, 100
BstDEI CTNAG 2 cut(s) 36, 185
BstKTI GATC 1 cut(s) 238
BstMBI GATC 1 cut(s) 235
BstNI CCWGG 1 cut(s) 231
BstNSI RCATGY 1 cut(s) 59
BstSCI CCNGG 1 cut(s) 229
BstX2I RGATCY 1 cut(s) 235
BstYI RGATCY 1 cut(s) 235
BtrI CACGTC 1 cut(s) 122
CaiI CAGNNNCTG 1 cut(s) 52
Cfr13I GGNCC 2 cut(s) 212, 224
CviAII CATG 2 cut(s) 56, 128
CviJI RGCY 1 cut(s) 27
CviKI_1 RGCY 1 cut(s) 27
DdeI CTNAG 2 cut(s) 36, 185
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
Eco47I GGWCC 2 cut(s) 212, 224
EcoO109I RGGNCCY 1 cut(s) 224
EcoRII CCWGG 1 cut(s) 229
FaeI CATG 2 cut(s) 59, 131
FaiI YATR 4 cut(s) 57, 129, 243, 247
FatI CATG 2 cut(s) 55, 127
GsuI CTGGAG 2 cut(s) 132, 216
Hin1II CATG 2 cut(s) 59, 131
HphI GGTGA 1 cut(s) 91
Hpy188I TCNGA 2 cut(s) 93, 104
Hpy188III TCNNGA 3 cut(s) 38, 61, 251
HpyAV CCTTC 3 cut(s) 76, 110, 263
HpyCH4III ACNGT 2 cut(s) 48, 100
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 2 cut(s) 55, 151
HpyF3I CTNAG 2 cut(s) 36, 185
HpySE526I ACGT 1 cut(s) 121
Hsp92II CATG 2 cut(s) 59, 131
Kzo9I GATC 1 cut(s) 235
LpnPI CCDG 8 cut(s) 23, 46, 96, 157, 180, 195, 216, 243
MaeII ACGT 1 cut(s) 121
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 1 cut(s) 272
MflI RGATCY 1 cut(s) 235
MluCI AATT 2 cut(s) 153, 273
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 6 cut(s) 168, 171, 193, 197, 212, 237
MseI TTAA 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 231
MvaI CCWGG 1 cut(s) 231
NdeII GATC 1 cut(s) 235
NlaIII CATG 2 cut(s) 59, 131
NlaIV GGNNCC 1 cut(s) 225
NspI RCATGY 1 cut(s) 59
PpuMI RGGWCCY 1 cut(s) 224
Psp5II RGGWCCY 1 cut(s) 224
Psp6I CCWGG 1 cut(s) 229
PspGI CCWGG 1 cut(s) 229
PspN4I GGNNCC 1 cut(s) 225
PspPI GGNCC 2 cut(s) 212, 224
PspPPI RGGWCCY 1 cut(s) 224
PstNI CAGNNNCTG 1 cut(s) 52
PsuI RGATCY 1 cut(s) 235
SaqAI TTAA 1 cut(s) 132
Sau3AI GATC 1 cut(s) 235
Sau96I GGNCC 2 cut(s) 212, 224
ScrFI CCNGG 1 cut(s) 231
SetI ASST 4 cut(s) 22, 87, 124, 208
SinI GGWCC 2 cut(s) 212, 224
Sse9I AATT 2 cut(s) 153, 273
StyD4I CCNGG 1 cut(s) 229
TaaI ACNGT 2 cut(s) 48, 100
TaiI ACGT 1 cut(s) 124
TaqII GACCGA 1 cut(s) 229
TasI AATT 2 cut(s) 153, 273
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 1 cut(s) 116
VpaK11BI GGWCC 2 cut(s) 212, 224
XapI RAATTY 2 cut(s) 153, 273
XceI RCATGY 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.