Rmu_sc0004670.1_g000028

Chaperone protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004670.1
Physical Location & Seq
Forward (+)
147611 .. 147971
361 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004670.1_g000028.1.cds

Sequence Viewer

Length: 225 bp
atgggctactttgaagtttataacgcaaccatagagatgaggccggtttctgcatgtctggattgtggtggagatggtgaagttatttctgaatactgtcggaagtgctctggagaaggacgtgttcgtgttaagaaaagtatcaaagtgaaagttcctcctcgtgttagcaggggaagtattcttagagttgctggagagggaggtgctggaccgagagggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

7.89

Weight (kDa)

9.3

Isoelectric Point (pI)

32.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 21
AflIII ACRYGT 1 cut(s) 121
AgsI TTSAA 1 cut(s) 14
AjiI CACGTC 1 cut(s) 122
Alw21I GWGCWC 1 cut(s) 110
AoxI GGCC 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 212
AsuHPI GGTGA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 212
BauI CACGAG 1 cut(s) 162
Bbv12I GWGCWC 1 cut(s) 110
BccI CCATC 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 212
BmgBI CACGTC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 212
BpmI CTGGAG 2 cut(s) 132, 216
Bse118I RCCGGY 1 cut(s) 43
BseRI GAGGAG 1 cut(s) 150
BshFI GGCC 1 cut(s) 43
BsiHKAI GWGCWC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 44
BsnI GGCC 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 110
BspANI GGCC 1 cut(s) 43
BsrFI RCCGGY 1 cut(s) 43
BssAI RCCGGY 1 cut(s) 43
BssSI CACGAG 1 cut(s) 162
Bst2BI CACGAG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 98
BstDEI CTNAG 1 cut(s) 185
BstNSI RCATGY 1 cut(s) 57
BsuRI GGCC 1 cut(s) 43
BtrI CACGTC 1 cut(s) 122
Cfr10I RCCGGY 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 212
CviAII CATG 1 cut(s) 54
CviJI RGCY 2 cut(s) 6, 43
CviKI_1 RGCY 2 cut(s) 6, 43
DdeI CTNAG 1 cut(s) 185
Eco47I GGWCC 1 cut(s) 212
FaeI CATG 1 cut(s) 57
FaiI YATR 3 cut(s) 21, 32, 55
FatI CATG 1 cut(s) 53
GsuI CTGGAG 2 cut(s) 132, 216
HaeIII GGCC 1 cut(s) 43
HapII CCGG 1 cut(s) 44
Hin1II CATG 1 cut(s) 57
HpaII CCGG 1 cut(s) 44
HphI GGTGA 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 91, 102
Hpy188III TCNNGA 2 cut(s) 59, 111
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 185
HpySE526I ACGT 1 cut(s) 121
Hsp92II CATG 1 cut(s) 57
LpnPI CCDG 6 cut(s) 44, 57, 96, 157, 180, 195
MaeII ACGT 1 cut(s) 121
MhlI GDGCHC 1 cut(s) 110
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 6 cut(s) 33, 168, 171, 193, 197, 212
MseI TTAA 1 cut(s) 132
MslI CAYNNNNRTG 1 cut(s) 35
MspI CCGG 1 cut(s) 44
NlaIII CATG 1 cut(s) 57
NspI RCATGY 1 cut(s) 57
PsiI TTATAA 1 cut(s) 21
PspPI GGNCC 1 cut(s) 212
RseI CAYNNNNRTG 1 cut(s) 35
SaqAI TTAA 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 212
SduI GDGCHC 1 cut(s) 110
SetI ASST 2 cut(s) 124, 208
SinI GGWCC 1 cut(s) 212
SmiMI CAYNNNNRTG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 98
TaiI ACGT 1 cut(s) 124
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 212
XceI RCATGY 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.