RchiOBHm_Chr2g0165661

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
80551320 .. 80551841
522 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 333 bp
ATGAACTATAATATGCAACAAATGGATCATACTCTTTCTGATCTTCTCAATATGCTGGTAACAGCTGAGAAACAAATCAAGAAAGAGAGTGGGAGTGCGGCCATTATCGCTTCTTCTTCATCCAGTAAGTCCAAAGGCAAAGGGAAGAAGAAACAAGTGATAAAGCCTAAGGGAGCAGTCCAAAAGAAGAAGAAGAAGGAACAAAAGGAACCAAAAGGTATTTGTTTCTTTTGCAACAAAGATGGGCACTGGAAGAGGAATTGCAAAGCTTATCTTGCATCCTTGAAGAACAAGTCTTCAACGGAAGGACCTAGTGGGAGCAAGGAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.12

Weight (kDa)

9.95

Isoelectric Point (pI)

29.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 98
AclWI GGATC 1 cut(s) 33
AcoI YGGCCR 1 cut(s) 99
AgsI TTSAA 2 cut(s) 286, 300
AluBI AGCT 3 cut(s) 65, 269, 329
AluI AGCT 3 cut(s) 65, 269, 329
AlwI GGATC 1 cut(s) 33
AoxI GGCC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 308
AvaII GGWCC 1 cut(s) 308
AxyI CCTNAGG 1 cut(s) 168
BaeGI GKGCMC 1 cut(s) 249
BbsI GAAGAC 1 cut(s) 288
BccI CCATC 1 cut(s) 236
BfaI CTAG 1 cut(s) 312
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
Bme18I GGWCC 1 cut(s) 308
BmgT120I GGNCC 1 cut(s) 308
BmiI GGNNCC 1 cut(s) 210
BmsI GCATC 1 cut(s) 287
BpiI GAAGAC 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 123, 254
Bse21I CCTNAGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 119, 278
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 2 cut(s) 123, 254
BseSI GKGCMC 1 cut(s) 249
BshFI GGCC 1 cut(s) 101
BsnI GGCC 1 cut(s) 101
Bsp1286I GDGCHC 1 cut(s) 249
Bsp143I GATC 2 cut(s) 25, 40
BspACI CCGC 1 cut(s) 98
BspANI GGCC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 1 cut(s) 33
BsrI ACTGG 2 cut(s) 123, 254
BssMI GATC 2 cut(s) 25, 40
Bst6I CTCTTC 1 cut(s) 248
BstDEI CTNAG 2 cut(s) 66, 168
BstF5I GGATG 2 cut(s) 119, 278
BstKTI GATC 2 cut(s) 28, 43
BstMBI GATC 2 cut(s) 25, 40
BstMWI GCNNNNNNNGC 2 cut(s) 107, 275
BstSLI GKGCMC 1 cut(s) 249
BstV2I GAAGAC 1 cut(s) 288
Bsu36I CCTNAGG 1 cut(s) 168
BsuRI GGCC 1 cut(s) 101
BtsCI GGATG 2 cut(s) 119, 278
BtsIMutI CAGTG 1 cut(s) 247
Cfr13I GGNCC 1 cut(s) 308
CviJI RGCY 5 cut(s) 65, 101, 166, 269, 329
CviKI_1 RGCY 5 cut(s) 65, 101, 166, 269, 329
DdeI CTNAG 2 cut(s) 66, 168
DpnI GATC 2 cut(s) 27, 42
DpnII GATC 2 cut(s) 25, 40
EaeI YGGCCR 1 cut(s) 99
Eam1104I CTCTTC 1 cut(s) 248
EarI CTCTTC 1 cut(s) 248
Eco47I GGWCC 1 cut(s) 308
Eco81I CCTNAGG 1 cut(s) 168
EcoO109I RGGNCCY 1 cut(s) 308
FaiI YATR 4 cut(s) 9, 14, 30, 53
FalI AAGNNNNNCTT 2 cut(s) 258, 290
Fnu4HI GCNGC 1 cut(s) 99
FokI GGATG 2 cut(s) 106, 265
Fsp4HI GCNGC 1 cut(s) 99
FspBI CTAG 1 cut(s) 312
GluI GCNGC 1 cut(s) 99
HaeIII GGCC 1 cut(s) 101
HindIII AAGCTT 2 cut(s) 267, 327
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 79
HpyAV CCTTC 2 cut(s) 190, 299
HpyCH4V TGCA 4 cut(s) 16, 234, 264, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 275
HpyF3I CTNAG 2 cut(s) 66, 168
Kzo9I GATC 2 cut(s) 25, 40
LmnI GCTCC 2 cut(s) 173, 318
LpnPI CCDG 3 cut(s) 41, 136, 235
LweI GCATC 1 cut(s) 287
MaeI CTAG 1 cut(s) 312
MaeIII GTNAC 1 cut(s) 58
MalI GATC 2 cut(s) 27, 42
MboI GATC 2 cut(s) 25, 40
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 1 cut(s) 259
MnlI CCTC 1 cut(s) 249
MseI TTAA 1 cut(s) 331
MspA1I CMGCKG 1 cut(s) 65
MwoI GCNNNNNNNGC 2 cut(s) 107, 275
NdeII GATC 2 cut(s) 25, 40
NlaIV GGNNCC 1 cut(s) 210
PkrI GCNGC 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 308
Psp5II RGGWCCY 1 cut(s) 308
PspN4I GGNNCC 1 cut(s) 210
PspPI GGNCC 1 cut(s) 308
PspPPI RGGWCCY 1 cut(s) 308
PvuII CAGCTG 1 cut(s) 65
SaqAI TTAA 1 cut(s) 331
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 2 cut(s) 25, 40
Sau96I GGNCC 1 cut(s) 308
SduI GDGCHC 1 cut(s) 249
SetI ASST 5 cut(s) 67, 220, 271, 313, 331
SfaNI GCATC 1 cut(s) 287
SgeI CNNG 9 cut(s) 68, 91, 135, 167, 262, 287, 295, 304, 324
SinI GGWCC 1 cut(s) 308
Sse9I AATT 1 cut(s) 259
SsiI CCGC 1 cut(s) 98
SspMI CTAG 1 cut(s) 312
TasI AATT 1 cut(s) 259
TauI GCSGC 1 cut(s) 101
Tru1I TTAA 1 cut(s) 331
Tru9I TTAA 1 cut(s) 331
TscAI CASTG 1 cut(s) 254
TspDTI ATGAA 2 cut(s) 17, 108
TspGWI ACGGA 1 cut(s) 317
TspRI CASTG 1 cut(s) 254
VpaK11BI GGWCC 1 cut(s) 308
XspI CTAG 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.