Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000070.1

Orthogroup ID

OG0002402

Physical Location & Seq

Genomic Coordinates Reverse (-)

29810 .. 30286

Gene Structure 477 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000070.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 477 bp

atgtcaggacatcctatcactaaaattcttaacgagaatagtcttgagggcccaaacttcaatgagtggctccgcaatttgaaaattgtattgacatttgataagattgtttatactcttcttgagggcccaaacgttgatgcaactgatgagcaacgtgttgcttatcaaaagcataaggatgatgatacgcaagctaaatgtgttatgcttgcatctatgaactcacaacttcagaagcaacatgagaacatggataacgccatttctattttaattcatctcactgaattgtttggtgagagaaatagaaatgtgcgattcacagctgtcaatgagcttgttaagacaaagcatgtgaggggtgctcctgtgcatcaacatggtctcaaaatgattggactcattgagcgaattcaagacctaggttttgcacttgatgcggagctagctcaagatcttcttctttcctcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

158

Amino Acids

17.93

Weight (kDa)

5.95

Isoelectric Point (pI)

28.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002402)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g29991
malus_domestica	MD00G1044200.v1.1
prunus_persica	Prupe.2G062600_v2.0.a1 Prupe.2G064700_v2.0.a1 Prupe.6G167800_v2.0.a1
pyrus_communis	pycom13g29530 pycom17g02500 pycom39g00040 pycom976g00080
rosa_chinensis	RchiOBHm_Chr1g0376911 RchiOBHm_Chr1g0379561 RchiOBHm_Chr2g0165661 RchiOBHm_Chr2g0176521
rosa_multiflora	Rmu_sc0000070.1_g000011 Rmu_sc0000555.1_g000020 Rmu_sc0001291.1_g000051 Rmu_sc0001306.1_g000003 Rmu_sc0005142.1_g000016 Rmu_ssc0000389.1_g000014
rosa_roxburghii	Rroxscaffold_2G00096870 Rroxscaffold_5G00384810 Rroxscaffold_6G00394930
rosa_samantha	Rh1CG138000 Rh1CG192400 Rh7BG220700
rosa_wichuraiana	Rw0G002230 Rw0G012080 Rw1G007200 Rw1G008660 Rw1G011890 Rw2G018430 Rw3G008190 Rw3G020340 Rw3G024460 Rw4G000210 Rw5G007300 Rw5G015820 Rw5G032410 Rw5G048130 Rw5G049610 Rw7G025770 Rw7G028470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	73, 443
AclI	AACGTT	1 cut(s)	135
AcsI	RAATTY	2 cut(s)	24, 414
AcuI	CTGAAG	1 cut(s)	218
AflIII	ACRYGT	1 cut(s)	157
AgsI	TTSAA	3 cut(s)	61, 82, 419
AluBI	AGCT	5 cut(s)	197, 329, 340, 448, 452
AluI	AGCT	5 cut(s)	197, 329, 340, 448, 452
Alw21I	GWGCWC	1 cut(s)	370
Alw26I	GTCTC	1 cut(s)	392
AoxI	GGCC	2 cut(s)	49, 127
ApaI	GGGCCC	2 cut(s)	53, 131
ApoI	RAATTY	2 cut(s)	24, 414
ArsI	GACNNNNNNTTYG	2 cut(s)	413, 445
AspA2I	CCTAGG	1 cut(s)	424
AspS9I	GGNCC	4 cut(s)	49, 50, 127, 128
AsuHPI	GGTGA	1 cut(s)	311
AsuNHI	GCTAGC	1 cut(s)	448
AvrII	CCTAGG	1 cut(s)	424
BaeGI	GKGCMC	2 cut(s)	53, 131
BanII	GRGCYC	2 cut(s)	53, 131
Bbv12I	GWGCWC	1 cut(s)	370
BcoDI	GTCTC	1 cut(s)	392
BfaI	CTAG	3 cut(s)	425, 449, 475
BglII	AGATCT	1 cut(s)	457
BlnI	CCTAGG	1 cut(s)	424
BmgT120I	GGNCC	4 cut(s)	49, 50, 127, 128
BmiI	GGNNCC	3 cut(s)	51, 71, 129
BmsI	GCATC	4 cut(s)	130, 224, 385, 430
BmtI	GCTAGC	1 cut(s)	452
BplI	GAGNNNNNCTC	2 cut(s)	352, 384
BpuEI	CTTGAG	3 cut(s)	65, 143, 438
BsaI	GGTCTC	1 cut(s)	392
BsaJI	CCNNGG	1 cut(s)	424
BseDI	CCNNGG	1 cut(s)	424
BseGI	GGATG	2 cut(s)	10, 187
BseSI	GKGCMC	2 cut(s)	53, 131
BshFI	GGCC	2 cut(s)	51, 129
BsiHKAI	GWGCWC	1 cut(s)	370
BsmAI	GTCTC	1 cut(s)	392
BsnI	GGCC	2 cut(s)	51, 129
Bso31I	GGTCTC	1 cut(s)	392
Bsp120I	GGGCCC	2 cut(s)	49, 127
Bsp1286I	GDGCHC	3 cut(s)	53, 131, 370
Bsp143I	GATC	1 cut(s)	457
BspACI	CCGC	2 cut(s)	73, 443
BspANI	GGCC	2 cut(s)	51, 129
BspLI	GGNNCC	3 cut(s)	51, 71, 129
BspOI	GCTAGC	1 cut(s)	452
BspTNI	GGTCTC	1 cut(s)	392
BssECI	CCNNGG	1 cut(s)	424
BssMI	GATC	1 cut(s)	457
BssT1I	CCWWGG	1 cut(s)	424
Bst6I	CTCTTC	1 cut(s)	123
BstAPI	GCANNNNNTGC	1 cut(s)	440
BstC8I	GCNNGC	3 cut(s)	195, 213, 450
BstF5I	GGATG	2 cut(s)	10, 187
BstKTI	GATC	1 cut(s)	460
BstMAI	GTCTC	1 cut(s)	392
BstMBI	GATC	1 cut(s)	457
BstMWI	GCNNNNNNNGC	2 cut(s)	440, 449
BstNSI	RCATGY	1 cut(s)	359
BstSLI	GKGCMC	2 cut(s)	53, 131
BstX2I	RGATCY	1 cut(s)	457
BstYI	RGATCY	1 cut(s)	457
BsuRI	GGCC	2 cut(s)	51, 129
BtsCI	GGATG	2 cut(s)	10, 187
BtsIMutI	CAGTG	1 cut(s)	285
Cac8I	GCNNGC	3 cut(s)	195, 213, 450
Cfr13I	GGNCC	4 cut(s)	49, 50, 127, 128
CviAII	CATG	4 cut(s)	245, 253, 356, 383
CviJI	RGCY	8 cut(s)	51, 70, 129, 197, 329, 340, 448, 452
CviKI_1	RGCY	8 cut(s)	51, 70, 129, 197, 329, 340, 448, 452
DpnI	GATC	1 cut(s)	459
DpnII	GATC	1 cut(s)	457
Eam1104I	CTCTTC	1 cut(s)	123
EarI	CTCTTC	1 cut(s)	123
Eco130I	CCWWGG	1 cut(s)	424
Eco24I	GRGCYC	2 cut(s)	53, 131
Eco31I	GGTCTC	1 cut(s)	392
Eco57I	CTGAAG	1 cut(s)	218
EcoO109I	RGGNCCY	2 cut(s)	49, 127
EcoRI	GAATTC	1 cut(s)	414
EcoT14I	CCWWGG	1 cut(s)	424
EcoT38I	GRGCYC	2 cut(s)	53, 131
ErhI	CCWWGG	1 cut(s)	424
FaeI	CATG	4 cut(s)	248, 256, 359, 386
FaiI	YATR	8 cut(s)	114, 177, 209, 221, 246, 254, 357, 384
FalI	AAGNNNNNCTT	1 cut(s)	447
FatI	CATG	4 cut(s)	244, 252, 355, 382
FokI	GGATG	1 cut(s)	194
FriOI	GRGCYC	2 cut(s)	53, 131
FspBI	CTAG	3 cut(s)	425, 449, 475
HaeIII	GGCC	2 cut(s)	51, 129
Hin1II	CATG	4 cut(s)	248, 256, 359, 386
HinfI	GANTC	2 cut(s)	321, 402
HphI	GGTGA	1 cut(s)	311
Hpy188I	TCNGA	1 cut(s)	237
Hpy188III	TCNNGA	5 cut(s)	6, 44, 122, 419, 455
HpyCH4IV	ACGT	2 cut(s)	135, 157
HpyCH4V	TGCA	4 cut(s)	143, 215, 376, 434
HpyF10VI	GCNNNNNNNGC	2 cut(s)	440, 449
HpySE526I	ACGT	2 cut(s)	135, 157
Hsp92II	CATG	4 cut(s)	248, 256, 359, 386
Kzo9I	GATC	1 cut(s)	457
LmnI	GCTCC	3 cut(s)	75, 373, 445
LpnPI	CCDG	1 cut(s)	384
LweI	GCATC	4 cut(s)	130, 224, 385, 430
MaeI	CTAG	3 cut(s)	425, 449, 475
MaeII	ACGT	2 cut(s)	135, 157
MalI	GATC	1 cut(s)	459
MboI	GATC	1 cut(s)	457
MboII	GAAGA	3 cut(s)	110, 452, 455
MflI	RGATCY	1 cut(s)	457
MhlI	GDGCHC	3 cut(s)	53, 131, 370
MluCI	AATT	6 cut(s)	24, 76, 84, 276, 290, 414
MlyI	GAGTC	1 cut(s)	396
MnlI	CCTC	3 cut(s)	40, 118, 354
MseI	TTAA	3 cut(s)	30, 275, 345
MslI	CAYNNNNRTG	2 cut(s)	180, 381
MspA1I	CMGCKG	1 cut(s)	329
MwoI	GCNNNNNNNGC	2 cut(s)	440, 449
NdeII	GATC	1 cut(s)	457
NheI	GCTAGC	1 cut(s)	448
NlaIII	CATG	4 cut(s)	248, 256, 359, 386
NlaIV	GGNNCC	3 cut(s)	51, 71, 129
NspI	RCATGY	1 cut(s)	359
PfeI	GAWTC	1 cut(s)	321
PleI	GAGTC	1 cut(s)	396
PpsI	GAGTC	1 cut(s)	396
Psp1406I	AACGTT	1 cut(s)	135
PspN4I	GGNNCC	3 cut(s)	51, 71, 129
PspOMI	GGGCCC	2 cut(s)	49, 127
PspPI	GGNCC	4 cut(s)	49, 50, 127, 128
PsuI	RGATCY	1 cut(s)	457
PvuII	CAGCTG	1 cut(s)	329
RseI	CAYNNNNRTG	2 cut(s)	180, 381
SaqAI	TTAA	3 cut(s)	30, 275, 345
Sau3AI	GATC	1 cut(s)	457
Sau96I	GGNCC	4 cut(s)	49, 50, 127, 128
SchI	GAGTC	1 cut(s)	396
SduI	GDGCHC	3 cut(s)	53, 131, 370
SetI	ASST	9 cut(s)	138, 160, 199, 331, 342, 426, 430, 450, 454
SfaNI	GCATC	4 cut(s)	130, 224, 385, 430
SmiMI	CAYNNNNRTG	2 cut(s)	180, 381
SmlI	CTYRAG	3 cut(s)	44, 122, 453
SmoI	CTYRAG	3 cut(s)	44, 122, 453
Sse9I	AATT	6 cut(s)	24, 76, 84, 276, 290, 414
SsiI	CCGC	2 cut(s)	73, 443
SspMI	CTAG	3 cut(s)	425, 449, 475
StyI	CCWWGG	1 cut(s)	424
TaiI	ACGT	2 cut(s)	138, 160
TasI	AATT	6 cut(s)	24, 76, 84, 276, 290, 414
TfiI	GAWTC	1 cut(s)	321
Tru1I	TTAA	3 cut(s)	30, 275, 345
Tru9I	TTAA	3 cut(s)	30, 275, 345
TscAI	CASTG	1 cut(s)	292
TspDTI	ATGAA	2 cut(s)	236, 269
TspRI	CASTG	1 cut(s)	292
XapI	RAATTY	2 cut(s)	24, 414
XceI	RCATGY	1 cut(s)	359
XmaJI	CCTAGG	1 cut(s)	424
XspI	CTAG	3 cut(s)	425, 449, 475

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.