Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000389.1

Orthogroup ID

OG0002402

Physical Location & Seq

Genomic Coordinates Forward (+)

82011 .. 82301

Gene Structure 291 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000389.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

atgtcaggacatcctatcaccaaaattctcaatgaaaatcgtcttgagggcccaaacttcaatgactggctcagcaatttgaaaattgtattgacattcgataagatcgcttatgtcttacaaaatgcaccccctcacactcttttggctcaagatgcaaccgatgagcaacgtgttgcttatcaaaagcataaggatgatgacactcaagctaaatgtgttatgcttgcatccatgaactcacaacttcagaagcaacatgagaatatggatagcgccagttctatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

96

Amino Acids

10.87

Weight (kDa)

5.69

Isoelectric Point (pI)

35.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002402)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g29991
malus_domestica	MD00G1044200.v1.1
prunus_persica	Prupe.2G062600_v2.0.a1 Prupe.2G064700_v2.0.a1 Prupe.6G167800_v2.0.a1
pyrus_communis	pycom13g29530 pycom17g02500 pycom39g00040 pycom976g00080
rosa_chinensis	RchiOBHm_Chr1g0376911 RchiOBHm_Chr1g0379561 RchiOBHm_Chr2g0165661 RchiOBHm_Chr2g0176521
rosa_multiflora	Rmu_sc0000070.1_g000011 Rmu_sc0000555.1_g000020 Rmu_sc0001291.1_g000051 Rmu_sc0001306.1_g000003 Rmu_sc0005142.1_g000016 Rmu_ssc0000389.1_g000014
rosa_roxburghii	Rroxscaffold_2G00096870 Rroxscaffold_5G00384810 Rroxscaffold_6G00394930
rosa_samantha	Rh1CG138000 Rh1CG192400 Rh7BG220700
rosa_wichuraiana	Rw0G002230 Rw0G012080 Rw1G007200 Rw1G008660 Rw1G011890 Rw2G018430 Rw3G008190 Rw3G020340 Rw3G024460 Rw4G000210 Rw5G007300 Rw5G015820 Rw5G032410 Rw5G048130 Rw5G049610 Rw7G025770 Rw7G028470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	24
AcuI	CTGAAG	1 cut(s)	233
AflIII	ACRYGT	1 cut(s)	172
AgsI	TTSAA	2 cut(s)	61, 82
AluBI	AGCT	1 cut(s)	212
AluI	AGCT	1 cut(s)	212
AoxI	GGCC	1 cut(s)	49
ApaI	GGGCCC	1 cut(s)	53
ApoI	RAATTY	1 cut(s)	24
AspLEI	GCGC	1 cut(s)	278
AspS9I	GGNCC	2 cut(s)	49, 50
AsuHPI	GGTGA	1 cut(s)	10
BaeGI	GKGCMC	1 cut(s)	53
BanII	GRGCYC	1 cut(s)	53
BfoI	RGCGCY	1 cut(s)	279
BlpI	GCTNAGC	1 cut(s)	71
BmgT120I	GGNCC	2 cut(s)	49, 50
BmiI	GGNNCC	1 cut(s)	51
BmsI	GCATC	2 cut(s)	145, 239
Bpu1102I	GCTNAGC	1 cut(s)	71
BpuEI	CTTGAG	3 cut(s)	65, 135, 192
Bse1I	ACTGG	2 cut(s)	71, 279
BseGI	GGATG	3 cut(s)	10, 202, 230
BseMII	CTCAG	1 cut(s)	85
BseNI	ACTGG	2 cut(s)	71, 279
BseSI	GKGCMC	1 cut(s)	53
BshFI	GGCC	1 cut(s)	51
BsnI	GGCC	1 cut(s)	51
Bsp120I	GGGCCC	1 cut(s)	49
Bsp1286I	GDGCHC	1 cut(s)	53
Bsp143I	GATC	1 cut(s)	105
Bsp1720I	GCTNAGC	1 cut(s)	71
BspANI	GGCC	1 cut(s)	51
BspCNI	CTCAG	1 cut(s)	84
BspLI	GGNNCC	1 cut(s)	51
BsrI	ACTGG	2 cut(s)	71, 279
BssMI	GATC	1 cut(s)	105
BstC8I	GCNNGC	1 cut(s)	228
BstDEI	CTNAG	1 cut(s)	71
BstF5I	GGATG	3 cut(s)	10, 202, 230
BstH2I	RGCGCY	1 cut(s)	279
BstHHI	GCGC	1 cut(s)	278
BstKTI	GATC	1 cut(s)	108
BstMBI	GATC	1 cut(s)	105
BstMWI	GCNNNNNNNGC	1 cut(s)	155
BstSLI	GKGCMC	1 cut(s)	53
BsuRI	GGCC	1 cut(s)	51
BtsCI	GGATG	3 cut(s)	10, 202, 230
Cac8I	GCNNGC	1 cut(s)	228
CfoI	GCGC	1 cut(s)	278
Cfr13I	GGNCC	2 cut(s)	49, 50
CviAII	CATG	2 cut(s)	235, 260
CviJI	RGCY	4 cut(s)	51, 70, 149, 212
CviKI_1	RGCY	4 cut(s)	51, 70, 149, 212
DdeI	CTNAG	1 cut(s)	71
DpnI	GATC	1 cut(s)	107
DpnII	GATC	1 cut(s)	105
Eco24I	GRGCYC	1 cut(s)	53
Eco57I	CTGAAG	1 cut(s)	233
EcoO109I	RGGNCCY	1 cut(s)	49
EcoT38I	GRGCYC	1 cut(s)	53
FaeI	CATG	2 cut(s)	238, 263
FaiI	YATR	8 cut(s)	114, 192, 224, 236, 261, 269, 287, 289
FatI	CATG	2 cut(s)	234, 259
FokI	GGATG	2 cut(s)	209, 217
FriOI	GRGCYC	1 cut(s)	53
GlaI	GCGC	1 cut(s)	277
HaeII	RGCGCY	1 cut(s)	279
HaeIII	GGCC	1 cut(s)	51
HhaI	GCGC	1 cut(s)	278
Hin1II	CATG	2 cut(s)	238, 263
Hin6I	GCGC	1 cut(s)	276
HinP1I	GCGC	1 cut(s)	276
HphI	GGTGA	1 cut(s)	10
Hpy188I	TCNGA	1 cut(s)	252
Hpy188III	TCNNGA	3 cut(s)	6, 44, 152
HpyCH4IV	ACGT	1 cut(s)	172
HpyCH4V	TGCA	3 cut(s)	128, 158, 230
HpyF10VI	GCNNNNNNNGC	1 cut(s)	155
HpyF3I	CTNAG	1 cut(s)	71
HpySE526I	ACGT	1 cut(s)	172
Hsp92II	CATG	2 cut(s)	238, 263
HspAI	GCGC	1 cut(s)	276
Kzo9I	GATC	1 cut(s)	105
LpnPI	CCDG	1 cut(s)	52
LweI	GCATC	2 cut(s)	145, 239
MaeII	ACGT	1 cut(s)	172
MalI	GATC	1 cut(s)	107
MboI	GATC	1 cut(s)	105
MhlI	GDGCHC	1 cut(s)	53
MluCI	AATT	3 cut(s)	24, 76, 84
MnlI	CCTC	2 cut(s)	40, 144
MslI	CAYNNNNRTG	1 cut(s)	195
MwoI	GCNNNNNNNGC	1 cut(s)	155
NdeII	GATC	1 cut(s)	105
NlaIII	CATG	2 cut(s)	238, 263
NlaIV	GGNNCC	1 cut(s)	51
PspN4I	GGNNCC	1 cut(s)	51
PspOMI	GGGCCC	1 cut(s)	49
PspPI	GGNCC	2 cut(s)	49, 50
RseI	CAYNNNNRTG	1 cut(s)	195
Sau3AI	GATC	1 cut(s)	105
Sau96I	GGNCC	2 cut(s)	49, 50
SduI	GDGCHC	1 cut(s)	53
SetI	ASST	2 cut(s)	175, 214
SfaNI	GCATC	2 cut(s)	145, 239
SgeI	CNNG	9 cut(s)	18, 56, 79, 164, 185, 221, 239, 247, 272
SmiMI	CAYNNNNRTG	1 cut(s)	195
SmlI	CTYRAG	3 cut(s)	44, 150, 207
SmoI	CTYRAG	3 cut(s)	44, 150, 207
Sse9I	AATT	3 cut(s)	24, 76, 84
TaiI	ACGT	1 cut(s)	175
TaqI	TCGA	1 cut(s)	99
TasI	AATT	3 cut(s)	24, 76, 84
TspDTI	ATGAA	2 cut(s)	48, 251
XapI	RAATTY	1 cut(s)	24

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.