Rw3G020340

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Reverse (-)
23792422 .. 23794760
2339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G020340.1

Sequence Viewer

Length: 513 bp
ATGTCAGGACATCCTATCACCAAAATTCTTAATAAAAATCGTCTTGAGGGCCCAAACTTCAATGACTGGCTCCGCAATTTGAAAATTGTATTGACATTCGATAAGATCGCTTATGTCTTACAAAATGCACCCCCTCACACTCCTTTGGCTCAAGATGTAACCGATGAGCAACGTGTTGCTTATCAAAAGCATAAGGATGATGACACTCAAGCTAAATGTGTTATGCTTGCGTCCATGAACTCACAACTTCAGAAGCAACATGAGAATATGGATAGCGCCAGTTCTATATTACTCCATCTCACTGAATTGTTTGGTGAAAGAAATAGAAATGTGCGCTTCACAGTAGTCAATGAGCTTGTCAAGACAAAACAAGTGAGGGGTGCACATGTGCATCAACATGGTCTAAAAATGATAGGCCTTATTGAGCAAATTCAAGACCTTGGATTTGCACTTGATGCGGAGCTAGCTCAAGATCTTCTTCTAACCTCCCTAGATGATTCATTTTCTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

170

Amino Acids

19.32

Weight (kDa)

6.29

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 52 - 169 1.2e-09 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 73, 458
AcsI RAATTY 2 cut(s) 24, 429
AcuI CTGAAG 1 cut(s) 233
AflIII ACRYGT 2 cut(s) 172, 385
AgsI TTSAA 3 cut(s) 61, 82, 434
AluBI AGCT 4 cut(s) 212, 355, 463, 467
AluI AGCT 4 cut(s) 212, 355, 463, 467
Alw21I GWGCWC 1 cut(s) 385
Alw44I GTGCAC 1 cut(s) 381
AoxI GGCC 2 cut(s) 49, 415
ApaI GGGCCC 1 cut(s) 53
ApaLI GTGCAC 1 cut(s) 381
ApoI RAATTY 2 cut(s) 24, 429
ArsI GACNNNNNNTTYG 2 cut(s) 428, 460
AspLEI GCGC 2 cut(s) 278, 336
AspS9I GGNCC 2 cut(s) 49, 50
AsuHPI GGTGA 2 cut(s) 10, 326
AsuNHI GCTAGC 1 cut(s) 463
BaeGI GKGCMC 2 cut(s) 53, 385
BanII GRGCYC 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 385
BccI CCATC 1 cut(s) 303
BfaI CTAG 2 cut(s) 464, 491
BfoI RGCGCY 1 cut(s) 279
BglII AGATCT 1 cut(s) 472
BmgT120I GGNCC 2 cut(s) 49, 50
BmiI GGNNCC 2 cut(s) 51, 71
BmsI GCATC 2 cut(s) 400, 445
BmtI GCTAGC 1 cut(s) 467
BpuEI CTTGAG 4 cut(s) 65, 135, 192, 453
BsaJI CCNNGG 1 cut(s) 439
Bse1I ACTGG 2 cut(s) 71, 279
BseDI CCNNGG 1 cut(s) 439
BseGI GGATG 2 cut(s) 10, 202
BseNI ACTGG 2 cut(s) 71, 279
BseSI GKGCMC 2 cut(s) 53, 385
BshFI GGCC 2 cut(s) 51, 417
BsiHKAI GWGCWC 1 cut(s) 385
BsnI GGCC 2 cut(s) 51, 417
Bsp120I GGGCCC 1 cut(s) 49
Bsp1286I GDGCHC 2 cut(s) 53, 385
Bsp143I GATC 2 cut(s) 105, 472
BspACI CCGC 2 cut(s) 73, 458
BspANI GGCC 2 cut(s) 51, 417
BspLI GGNNCC 2 cut(s) 51, 71
BspOI GCTAGC 1 cut(s) 467
BsrI ACTGG 2 cut(s) 71, 279
BssECI CCNNGG 1 cut(s) 439
BssMI GATC 2 cut(s) 105, 472
BssT1I CCWWGG 1 cut(s) 439
Bst4CI ACNGT 1 cut(s) 343
BstAPI GCANNNNNTGC 1 cut(s) 455
BstC8I GCNNGC 2 cut(s) 228, 465
BstF5I GGATG 2 cut(s) 10, 202
BstH2I RGCGCY 1 cut(s) 279
BstHHI GCGC 2 cut(s) 278, 336
BstKTI GATC 2 cut(s) 108, 475
BstMBI GATC 2 cut(s) 105, 472
BstMWI GCNNNNNNNGC 2 cut(s) 455, 464
BstNSI RCATGY 1 cut(s) 389
BstSLI GKGCMC 2 cut(s) 53, 385
BstX2I RGATCY 1 cut(s) 472
BstYI RGATCY 1 cut(s) 472
BsuRI GGCC 2 cut(s) 51, 417
BtsCI GGATG 2 cut(s) 10, 202
BtsIMutI CAGTG 1 cut(s) 300
Cac8I GCNNGC 2 cut(s) 228, 465
CfoI GCGC 2 cut(s) 278, 336
Cfr13I GGNCC 2 cut(s) 49, 50
CseI GACGC 1 cut(s) 219
CviAII CATG 4 cut(s) 235, 260, 386, 398
CviJI RGCY 8 cut(s) 51, 70, 149, 212, 355, 417, 463, 467
CviKI_1 RGCY 8 cut(s) 51, 70, 149, 212, 355, 417, 463, 467
DpnI GATC 2 cut(s) 107, 474
DpnII GATC 2 cut(s) 105, 472
Eco130I CCWWGG 1 cut(s) 439
Eco147I AGGCCT 1 cut(s) 417
Eco24I GRGCYC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 233
EcoO109I RGGNCCY 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 439
EcoT38I GRGCYC 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 439
FaeI CATG 4 cut(s) 238, 263, 389, 401
FaiI YATR 9 cut(s) 114, 192, 224, 236, 261, 269, 287, 387, 399
FalI AAGNNNNNCTT 2 cut(s) 462, 494
FatI CATG 4 cut(s) 234, 259, 385, 397
FokI GGATG 1 cut(s) 209
FriOI GRGCYC 1 cut(s) 53
FspBI CTAG 2 cut(s) 464, 491
GlaI GCGC 2 cut(s) 277, 335
HaeII RGCGCY 1 cut(s) 279
HaeIII GGCC 2 cut(s) 51, 417
HgaI GACGC 1 cut(s) 219
HhaI GCGC 2 cut(s) 278, 336
Hin1II CATG 4 cut(s) 238, 263, 389, 401
Hin6I GCGC 2 cut(s) 276, 334
HinP1I GCGC 2 cut(s) 276, 334
HinfI GANTC 1 cut(s) 497
HphI GGTGA 2 cut(s) 10, 326
Hpy166II GTNNAC 1 cut(s) 383
Hpy188I TCNGA 1 cut(s) 252
Hpy188III TCNNGA 6 cut(s) 6, 44, 152, 361, 434, 470
Hpy8I GTNNAC 1 cut(s) 383
HpyCH4III ACNGT 1 cut(s) 343
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 4 cut(s) 128, 383, 391, 449
HpyF10VI GCNNNNNNNGC 2 cut(s) 455, 464
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 4 cut(s) 238, 263, 389, 401
HspAI GCGC 2 cut(s) 276, 334
Kzo9I GATC 2 cut(s) 105, 472
LmnI GCTCC 2 cut(s) 75, 460
LpnPI CCDG 2 cut(s) 52, 292
LweI GCATC 2 cut(s) 400, 445
MaeI CTAG 2 cut(s) 464, 491
MaeII ACGT 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 157
MalI GATC 2 cut(s) 107, 474
MboI GATC 2 cut(s) 105, 472
MboII GAAGA 2 cut(s) 467, 470
MflI RGATCY 1 cut(s) 472
MhlI GDGCHC 2 cut(s) 53, 385
MluCI AATT 5 cut(s) 24, 76, 84, 305, 429
MnlI CCTC 4 cut(s) 40, 144, 369, 496
MseI TTAA 2 cut(s) 30, 511
MslI CAYNNNNRTG 2 cut(s) 195, 396
MwoI GCNNNNNNNGC 2 cut(s) 455, 464
NdeII GATC 2 cut(s) 105, 472
NheI GCTAGC 1 cut(s) 463
NlaIII CATG 4 cut(s) 238, 263, 389, 401
NlaIV GGNNCC 2 cut(s) 51, 71
NspI RCATGY 1 cut(s) 389
PceI AGGCCT 1 cut(s) 417
PciI ACATGT 1 cut(s) 385
PfeI GAWTC 1 cut(s) 497
PscI ACATGT 1 cut(s) 385
PspN4I GGNNCC 2 cut(s) 51, 71
PspOMI GGGCCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 49, 50
PsuI RGATCY 1 cut(s) 472
RseI CAYNNNNRTG 2 cut(s) 195, 396
SaqAI TTAA 2 cut(s) 30, 511
Sau3AI GATC 2 cut(s) 105, 472
Sau96I GGNCC 2 cut(s) 49, 50
SduI GDGCHC 2 cut(s) 53, 385
SetI ASST 7 cut(s) 175, 214, 357, 441, 465, 469, 488
SfaNI GCATC 2 cut(s) 400, 445
SmiMI CAYNNNNRTG 2 cut(s) 195, 396
SmlI CTYRAG 4 cut(s) 44, 150, 207, 468
SmoI CTYRAG 4 cut(s) 44, 150, 207, 468
Sse9I AATT 5 cut(s) 24, 76, 84, 305, 429
SseBI AGGCCT 1 cut(s) 417
SsiI CCGC 2 cut(s) 73, 458
SspMI CTAG 2 cut(s) 464, 491
StuI AGGCCT 1 cut(s) 417
StyI CCWWGG 1 cut(s) 439
TaaI ACNGT 1 cut(s) 343
TaiI ACGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 99
TasI AATT 5 cut(s) 24, 76, 84, 305, 429
TfiI GAWTC 1 cut(s) 497
Tru1I TTAA 2 cut(s) 30, 511
Tru9I TTAA 2 cut(s) 30, 511
TscAI CASTG 1 cut(s) 307
TspDTI ATGAA 2 cut(s) 251, 489
TspRI CASTG 1 cut(s) 307
VneI GTGCAC 1 cut(s) 381
XapI RAATTY 2 cut(s) 24, 429
XceI RCATGY 1 cut(s) 389
XspI CTAG 2 cut(s) 464, 491
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.