Rh7BG220700

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
19000801 .. 19001058
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG220700.1

Sequence Viewer

Length: 258 bp
ATGTCAGGACATCCTATCACCAAAATTCTCAATGAAAATCGTCTTGAGGGCCCAAACTTCAATGACTGGCTCCGCAATTTGAAAATTGTATTGACATTCGATAAGATCGCTTATGTCTTACAAAATGCACCTCCTCACACTCCATTGGCTCAAGATGCAACCGATGAGCAACGTGTTGCTTATCAAAAGCATAAGGATGATGACACGCAAGCTAAATGTGTTATGCTTGCATCCATGAACTCACAACTTCAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.72

Weight (kDa)

6.82

Isoelectric Point (pI)

34.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 73
AcsI RAATTY 1 cut(s) 24
AcuI CTGAAG 1 cut(s) 233
AflIII ACRYGT 1 cut(s) 172
AgsI TTSAA 2 cut(s) 61, 82
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
AoxI GGCC 1 cut(s) 49
ApaI GGGCCC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 24
AspS9I GGNCC 2 cut(s) 49, 50
AsuHPI GGTGA 1 cut(s) 10
BaeGI GKGCMC 1 cut(s) 53
BanII GRGCYC 1 cut(s) 53
BmgT120I GGNCC 2 cut(s) 49, 50
BmiI GGNNCC 2 cut(s) 51, 71
BmsI GCATC 2 cut(s) 145, 239
BpuEI CTTGAG 2 cut(s) 65, 135
Bse1I ACTGG 1 cut(s) 71
BseGI GGATG 3 cut(s) 10, 202, 230
BseNI ACTGG 1 cut(s) 71
BseRI GAGGAG 1 cut(s) 123
BseSI GKGCMC 1 cut(s) 53
BshFI GGCC 1 cut(s) 51
BsnI GGCC 1 cut(s) 51
Bsp120I GGGCCC 1 cut(s) 49
Bsp1286I GDGCHC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 105
BspACI CCGC 1 cut(s) 73
BspANI GGCC 1 cut(s) 51
BspLI GGNNCC 2 cut(s) 51, 71
BsrI ACTGG 1 cut(s) 71
BssMI GATC 1 cut(s) 105
BstC8I GCNNGC 2 cut(s) 210, 228
BstF5I GGATG 3 cut(s) 10, 202, 230
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstSLI GKGCMC 1 cut(s) 53
BsuRI GGCC 1 cut(s) 51
BtsCI GGATG 3 cut(s) 10, 202, 230
Cac8I GCNNGC 2 cut(s) 210, 228
Cfr13I GGNCC 2 cut(s) 49, 50
CviAII CATG 1 cut(s) 235
CviJI RGCY 4 cut(s) 51, 70, 149, 212
CviKI_1 RGCY 4 cut(s) 51, 70, 149, 212
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Eco24I GRGCYC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 233
EcoO109I RGGNCCY 1 cut(s) 49
EcoT38I GRGCYC 1 cut(s) 53
FaeI CATG 1 cut(s) 238
FaiI YATR 4 cut(s) 114, 192, 224, 236
FatI CATG 1 cut(s) 234
FokI GGATG 2 cut(s) 209, 217
FriOI GRGCYC 1 cut(s) 53
HaeIII GGCC 1 cut(s) 51
Hin1II CATG 1 cut(s) 238
HphI GGTGA 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 252
Hpy188III TCNNGA 3 cut(s) 6, 44, 152
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 3 cut(s) 128, 158, 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 1 cut(s) 238
Kzo9I GATC 1 cut(s) 105
LmnI GCTCC 1 cut(s) 75
LpnPI CCDG 1 cut(s) 52
LweI GCATC 2 cut(s) 145, 239
MaeII ACGT 1 cut(s) 172
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MhlI GDGCHC 1 cut(s) 53
MluCI AATT 3 cut(s) 24, 76, 84
MnlI CCTC 3 cut(s) 40, 141, 144
MslI CAYNNNNRTG 1 cut(s) 195
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 105
NlaIII CATG 1 cut(s) 238
NlaIV GGNNCC 2 cut(s) 51, 71
PspN4I GGNNCC 2 cut(s) 51, 71
PspOMI GGGCCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 49, 50
RseI CAYNNNNRTG 1 cut(s) 195
Sau3AI GATC 1 cut(s) 105
Sau96I GGNCC 2 cut(s) 49, 50
SduI GDGCHC 1 cut(s) 53
SetI ASST 3 cut(s) 133, 175, 214
SfaNI GCATC 2 cut(s) 145, 239
SgeI CNNG 9 cut(s) 18, 56, 79, 164, 185, 217, 221, 239, 247
SmiMI CAYNNNNRTG 1 cut(s) 195
SmlI CTYRAG 2 cut(s) 44, 150
SmoI CTYRAG 2 cut(s) 44, 150
Sse9I AATT 3 cut(s) 24, 76, 84
SsiI CCGC 1 cut(s) 73
TaiI ACGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 99
TasI AATT 3 cut(s) 24, 76, 84
TspDTI ATGAA 2 cut(s) 48, 251
XapI RAATTY 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.