Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001306.1

Orthogroup ID

OG0002402

Physical Location & Seq

Genomic Coordinates Reverse (-)

1730 .. 2236

Gene Structure 507 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001306.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 507 bp

atgtcaggacatcctattaccaaaattctcaatgaaaatcgtcttgagggcccaaactttaatgattggctccgcaatttgaaaattatattgacattcgataagatcgcttatgccttacaaaatgcaccccttcacacccctttggctcaagatgcaaccgatgagcaaagtattgcttatcaaaagcaaaaggatgatgacactcaagctaaatgtgttatgcttgcatccatgaactcacaacttcataagcaacatgagaatatggatagcgccagttctatattactccatctcactgaattgtttggtgaaagaaatagaaatgtgcgcttcacagtagtcaatgagtttgtcaagataaaacatgtgaggggtgcacctgtgcatcaacatggtataaaaatgataagccttattgagcagattcaagaccttggatttgcacttgatgcggagctagctcaagatcttctaacctccctagatgatttattttcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

168

Amino Acids

19.06

Weight (kDa)

5.69

Isoelectric Point (pI)

39.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002402)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g29991
malus_domestica	MD00G1044200.v1.1
prunus_persica	Prupe.2G062600_v2.0.a1 Prupe.2G064700_v2.0.a1 Prupe.6G167800_v2.0.a1
pyrus_communis	pycom13g29530 pycom17g02500 pycom39g00040 pycom976g00080
rosa_chinensis	RchiOBHm_Chr1g0376911 RchiOBHm_Chr1g0379561 RchiOBHm_Chr2g0165661 RchiOBHm_Chr2g0176521
rosa_multiflora	Rmu_sc0000070.1_g000011 Rmu_sc0000555.1_g000020 Rmu_sc0001291.1_g000051 Rmu_sc0001306.1_g000003 Rmu_sc0005142.1_g000016 Rmu_ssc0000389.1_g000014
rosa_roxburghii	Rroxscaffold_2G00096870 Rroxscaffold_5G00384810 Rroxscaffold_6G00394930
rosa_samantha	Rh1CG138000 Rh1CG192400 Rh7BG220700
rosa_wichuraiana	Rw0G002230 Rw0G012080 Rw1G007200 Rw1G008660 Rw1G011890 Rw2G018430 Rw3G008190 Rw3G020340 Rw3G024460 Rw4G000210 Rw5G007300 Rw5G015820 Rw5G032410 Rw5G048130 Rw5G049610 Rw7G025770 Rw7G028470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	73, 458
AcsI	RAATTY	1 cut(s)	24
AflIII	ACRYGT	1 cut(s)	370
AgsI	TTSAA	2 cut(s)	82, 434
AluBI	AGCT	3 cut(s)	212, 463, 467
AluI	AGCT	3 cut(s)	212, 463, 467
Alw21I	GWGCWC	1 cut(s)	385
Alw44I	GTGCAC	1 cut(s)	381
AoxI	GGCC	1 cut(s)	49
ApaI	GGGCCC	1 cut(s)	53
ApaLI	GTGCAC	1 cut(s)	381
ApoI	RAATTY	1 cut(s)	24
ArsI	GACNNNNNNTTYG	2 cut(s)	428, 460
AspLEI	GCGC	2 cut(s)	278, 336
AspS9I	GGNCC	2 cut(s)	49, 50
AsuHPI	GGTGA	1 cut(s)	326
AsuNHI	GCTAGC	1 cut(s)	463
BaeGI	GKGCMC	2 cut(s)	53, 385
BanII	GRGCYC	1 cut(s)	53
Bbv12I	GWGCWC	1 cut(s)	385
BccI	CCATC	1 cut(s)	303
BfaI	CTAG	2 cut(s)	464, 488
BfoI	RGCGCY	1 cut(s)	279
BglII	AGATCT	1 cut(s)	472
BmgT120I	GGNCC	2 cut(s)	49, 50
BmiI	GGNNCC	2 cut(s)	51, 71
BmsI	GCATC	4 cut(s)	145, 239, 400, 445
BmtI	GCTAGC	1 cut(s)	467
BpuEI	CTTGAG	4 cut(s)	65, 135, 192, 453
BsaJI	CCNNGG	1 cut(s)	439
Bse1I	ACTGG	1 cut(s)	279
BseDI	CCNNGG	1 cut(s)	439
BseGI	GGATG	3 cut(s)	10, 202, 230
BseNI	ACTGG	1 cut(s)	279
BseSI	GKGCMC	2 cut(s)	53, 385
BshFI	GGCC	1 cut(s)	51
BsiHKAI	GWGCWC	1 cut(s)	385
BsnI	GGCC	1 cut(s)	51
Bsp120I	GGGCCC	1 cut(s)	49
Bsp1286I	GDGCHC	2 cut(s)	53, 385
Bsp143I	GATC	2 cut(s)	105, 472
BspACI	CCGC	2 cut(s)	73, 458
BspANI	GGCC	1 cut(s)	51
BspLI	GGNNCC	2 cut(s)	51, 71
BspOI	GCTAGC	1 cut(s)	467
BsrI	ACTGG	1 cut(s)	279
BssECI	CCNNGG	1 cut(s)	439
BssMI	GATC	2 cut(s)	105, 472
BssT1I	CCWWGG	1 cut(s)	439
Bst4CI	ACNGT	1 cut(s)	343
BstAPI	GCANNNNNTGC	1 cut(s)	455
BstC8I	GCNNGC	2 cut(s)	228, 465
BstDEI	CTNAG	1 cut(s)	504
BstF5I	GGATG	3 cut(s)	10, 202, 230
BstH2I	RGCGCY	1 cut(s)	279
BstHHI	GCGC	2 cut(s)	278, 336
BstKTI	GATC	2 cut(s)	108, 475
BstMBI	GATC	2 cut(s)	105, 472
BstMWI	GCNNNNNNNGC	3 cut(s)	155, 455, 464
BstNSI	RCATGY	1 cut(s)	374
BstSLI	GKGCMC	2 cut(s)	53, 385
BstX2I	RGATCY	1 cut(s)	472
BstYI	RGATCY	1 cut(s)	472
BsuRI	GGCC	1 cut(s)	51
BtsCI	GGATG	3 cut(s)	10, 202, 230
BtsIMutI	CAGTG	1 cut(s)	300
Cac8I	GCNNGC	2 cut(s)	228, 465
CfoI	GCGC	2 cut(s)	278, 336
Cfr13I	GGNCC	2 cut(s)	49, 50
CviAII	CATG	4 cut(s)	235, 260, 371, 398
CviJI	RGCY	7 cut(s)	51, 70, 149, 212, 417, 463, 467
CviKI_1	RGCY	7 cut(s)	51, 70, 149, 212, 417, 463, 467
DdeI	CTNAG	1 cut(s)	504
DpnI	GATC	2 cut(s)	107, 474
DpnII	GATC	2 cut(s)	105, 472
Eco130I	CCWWGG	1 cut(s)	439
Eco24I	GRGCYC	1 cut(s)	53
EcoO109I	RGGNCCY	1 cut(s)	49
EcoT14I	CCWWGG	1 cut(s)	439
EcoT38I	GRGCYC	1 cut(s)	53
ErhI	CCWWGG	1 cut(s)	439
FaeI	CATG	4 cut(s)	238, 263, 374, 401
FalI	AAGNNNNNCTT	2 cut(s)	163, 195
FatI	CATG	4 cut(s)	234, 259, 370, 397
FokI	GGATG	2 cut(s)	209, 217
FriOI	GRGCYC	1 cut(s)	53
FspBI	CTAG	2 cut(s)	464, 488
GlaI	GCGC	2 cut(s)	277, 335
HaeII	RGCGCY	1 cut(s)	279
HaeIII	GGCC	1 cut(s)	51
HhaI	GCGC	2 cut(s)	278, 336
Hin1II	CATG	4 cut(s)	238, 263, 374, 401
Hin6I	GCGC	2 cut(s)	276, 334
HinP1I	GCGC	2 cut(s)	276, 334
HinfI	GANTC	1 cut(s)	430
HphI	GGTGA	1 cut(s)	326
Hpy166II	GTNNAC	1 cut(s)	383
Hpy188III	TCNNGA	6 cut(s)	6, 44, 152, 361, 434, 470
Hpy8I	GTNNAC	1 cut(s)	383
HpyAV	CCTTC	1 cut(s)	143
HpyCH4III	ACNGT	1 cut(s)	343
HpyCH4V	TGCA	6 cut(s)	128, 158, 230, 383, 391, 449
HpyF10VI	GCNNNNNNNGC	3 cut(s)	155, 455, 464
HpyF3I	CTNAG	1 cut(s)	504
Hsp92II	CATG	4 cut(s)	238, 263, 374, 401
HspAI	GCGC	2 cut(s)	276, 334
Kzo9I	GATC	2 cut(s)	105, 472
LmnI	GCTCC	2 cut(s)	75, 460
LpnPI	CCDG	2 cut(s)	292, 399
LweI	GCATC	4 cut(s)	145, 239, 400, 445
MaeI	CTAG	2 cut(s)	464, 488
MalI	GATC	2 cut(s)	107, 474
MboI	GATC	2 cut(s)	105, 472
MboII	GAAGA	1 cut(s)	467
MflI	RGATCY	1 cut(s)	472
MhlI	GDGCHC	2 cut(s)	53, 385
MluCI	AATT	4 cut(s)	24, 76, 84, 305
MnlI	CCTC	3 cut(s)	40, 369, 493
MseI	TTAA	1 cut(s)	60
MslI	CAYNNNNRTG	1 cut(s)	396
MwoI	GCNNNNNNNGC	3 cut(s)	155, 455, 464
NdeII	GATC	2 cut(s)	105, 472
NheI	GCTAGC	1 cut(s)	463
NlaIII	CATG	4 cut(s)	238, 263, 374, 401
NlaIV	GGNNCC	2 cut(s)	51, 71
NspI	RCATGY	1 cut(s)	374
PciI	ACATGT	1 cut(s)	370
PfeI	GAWTC	1 cut(s)	430
PscI	ACATGT	1 cut(s)	370
PspN4I	GGNNCC	2 cut(s)	51, 71
PspOMI	GGGCCC	1 cut(s)	49
PspPI	GGNCC	2 cut(s)	49, 50
PsuI	RGATCY	1 cut(s)	472
RseI	CAYNNNNRTG	1 cut(s)	396
SaqAI	TTAA	1 cut(s)	60
Sau3AI	GATC	2 cut(s)	105, 472
Sau96I	GGNCC	2 cut(s)	49, 50
SduI	GDGCHC	2 cut(s)	53, 385
SetI	ASST	6 cut(s)	214, 388, 441, 465, 469, 485
SfaNI	GCATC	4 cut(s)	145, 239, 400, 445
SmiMI	CAYNNNNRTG	1 cut(s)	396
SmlI	CTYRAG	4 cut(s)	44, 150, 207, 468
SmoI	CTYRAG	4 cut(s)	44, 150, 207, 468
Sse9I	AATT	4 cut(s)	24, 76, 84, 305
SsiI	CCGC	2 cut(s)	73, 458
SspMI	CTAG	2 cut(s)	464, 488
StyI	CCWWGG	1 cut(s)	439
TaaI	ACNGT	1 cut(s)	343
TaqI	TCGA	1 cut(s)	99
TasI	AATT	4 cut(s)	24, 76, 84, 305
TfiI	GAWTC	1 cut(s)	430
Tru1I	TTAA	1 cut(s)	60
Tru9I	TTAA	1 cut(s)	60
TscAI	CASTG	1 cut(s)	307
TspDTI	ATGAA	3 cut(s)	48, 239, 251
TspRI	CASTG	1 cut(s)	307
VneI	GTGCAC	1 cut(s)	381
XapI	RAATTY	1 cut(s)	24
XceI	RCATGY	1 cut(s)	374
XspI	CTAG	2 cut(s)	464, 488

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.