Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005142.1

Orthogroup ID

OG0002402

Physical Location & Seq

Genomic Coordinates Reverse (-)

80829 .. 81188

Gene Structure 360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005142.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atgaactcacaacttcagaagcaacatgagaatatggatagctccagttctatattactccatctcactgaattgtttggtgagagaaatagaaatgtgcgcttcacagtagtcgatgagcttgtcaagacaaaacaagtgaggggtgcacctgtgcatcaacatggatttgcacttgatacggagctagctcaagatcttcttctaacctccctagatgattcattttctcagttcataatgaactataatatgcaacaaatggatcataccctttctgatcttctaaatatgctggtaacaactgagaagcaaatcaagaaagagagtgggagtgtggcctttgttgcttcttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

119

Amino Acids

13.5

Weight (kDa)

5.4

Isoelectric Point (pI)

38.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002402)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g29991
malus_domestica	MD00G1044200.v1.1
prunus_persica	Prupe.2G062600_v2.0.a1 Prupe.2G064700_v2.0.a1 Prupe.6G167800_v2.0.a1
pyrus_communis	pycom13g29530 pycom17g02500 pycom39g00040 pycom976g00080
rosa_chinensis	RchiOBHm_Chr1g0376911 RchiOBHm_Chr1g0379561 RchiOBHm_Chr2g0165661 RchiOBHm_Chr2g0176521
rosa_multiflora	Rmu_sc0000070.1_g000011 Rmu_sc0000555.1_g000020 Rmu_sc0001291.1_g000051 Rmu_sc0001306.1_g000003 Rmu_sc0005142.1_g000016 Rmu_ssc0000389.1_g000014
rosa_roxburghii	Rroxscaffold_2G00096870 Rroxscaffold_5G00384810 Rroxscaffold_6G00394930
rosa_samantha	Rh1CG138000 Rh1CG192400 Rh7BG220700
rosa_wichuraiana	Rw0G002230 Rw0G012080 Rw1G007200 Rw1G008660 Rw1G011890 Rw2G018430 Rw3G008190 Rw3G020340 Rw3G024460 Rw4G000210 Rw5G007300 Rw5G015820 Rw5G032410 Rw5G048130 Rw5G049610 Rw7G025770 Rw7G028470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	273
AluBI	AGCT	4 cut(s)	42, 121, 187, 191
AluI	AGCT	4 cut(s)	42, 121, 187, 191
Alw21I	GWGCWC	1 cut(s)	151
Alw44I	GTGCAC	1 cut(s)	147
AlwI	GGATC	1 cut(s)	273
AoxI	GGCC	1 cut(s)	339
ApaLI	GTGCAC	1 cut(s)	147
AspLEI	GCGC	1 cut(s)	102
AsuHPI	GGTGA	1 cut(s)	92
AsuNHI	GCTAGC	1 cut(s)	187
BaeGI	GKGCMC	1 cut(s)	151
Bbv12I	GWGCWC	1 cut(s)	151
BccI	CCATC	1 cut(s)	69
BfaI	CTAG	2 cut(s)	188, 215
BglII	AGATCT	1 cut(s)	196
BmsI	GCATC	1 cut(s)	166
BmtI	GCTAGC	1 cut(s)	191
BpmI	CTGGAG	1 cut(s)	28
BpuEI	CTTGAG	1 cut(s)	177
Bse1I	ACTGG	1 cut(s)	45
BseMII	CTCAG	2 cut(s)	245, 297
BseNI	ACTGG	1 cut(s)	45
BseSI	GKGCMC	1 cut(s)	151
BshFI	GGCC	1 cut(s)	341
BsiHKAI	GWGCWC	1 cut(s)	151
BsnI	GGCC	1 cut(s)	341
Bsp1286I	GDGCHC	1 cut(s)	151
Bsp143I	GATC	3 cut(s)	196, 265, 280
BspANI	GGCC	1 cut(s)	341
BspCNI	CTCAG	2 cut(s)	244, 298
BspOI	GCTAGC	1 cut(s)	191
BspPI	GGATC	1 cut(s)	273
BsrI	ACTGG	1 cut(s)	45
BssMI	GATC	3 cut(s)	196, 265, 280
Bst4CI	ACNGT	1 cut(s)	109
BstC8I	GCNNGC	1 cut(s)	189
BstDEI	CTNAG	2 cut(s)	231, 306
BstHHI	GCGC	1 cut(s)	102
BstKTI	GATC	3 cut(s)	199, 268, 283
BstMBI	GATC	3 cut(s)	196, 265, 280
BstMWI	GCNNNNNNNGC	1 cut(s)	347
BstSLI	GKGCMC	1 cut(s)	151
BstX2I	RGATCY	1 cut(s)	196
BstYI	RGATCY	1 cut(s)	196
BsuRI	GGCC	1 cut(s)	341
BtsIMutI	CAGTG	1 cut(s)	66
Cac8I	GCNNGC	1 cut(s)	189
CfoI	GCGC	1 cut(s)	102
CviAII	CATG	2 cut(s)	26, 164
CviJI	RGCY	5 cut(s)	42, 121, 187, 191, 341
CviKI_1	RGCY	5 cut(s)	42, 121, 187, 191, 341
DdeI	CTNAG	2 cut(s)	231, 306
DpnI	GATC	3 cut(s)	198, 267, 282
DpnII	GATC	3 cut(s)	196, 265, 280
FaeI	CATG	2 cut(s)	29, 167
FaiI	YATR	9 cut(s)	27, 35, 53, 165, 239, 249, 254, 270, 293
FalI	AAGNNNNNCTT	2 cut(s)	186, 218
FatI	CATG	2 cut(s)	25, 163
FspBI	CTAG	2 cut(s)	188, 215
GlaI	GCGC	1 cut(s)	101
GsuI	CTGGAG	1 cut(s)	28
HaeIII	GGCC	1 cut(s)	341
HhaI	GCGC	1 cut(s)	102
Hin1II	CATG	2 cut(s)	29, 167
Hin6I	GCGC	1 cut(s)	100
HinP1I	GCGC	1 cut(s)	100
HinfI	GANTC	1 cut(s)	221
HphI	GGTGA	1 cut(s)	92
Hpy166II	GTNNAC	1 cut(s)	149
Hpy188I	TCNGA	2 cut(s)	18, 280
Hpy188III	TCNNGA	4 cut(s)	127, 194, 319, 357
Hpy8I	GTNNAC	1 cut(s)	149
HpyCH4III	ACNGT	1 cut(s)	109
HpyCH4V	TGCA	4 cut(s)	149, 157, 173, 256
HpyF10VI	GCNNNNNNNGC	1 cut(s)	347
HpyF3I	CTNAG	2 cut(s)	231, 306
Hsp92II	CATG	2 cut(s)	29, 167
HspAI	GCGC	1 cut(s)	100
Kzo9I	GATC	3 cut(s)	196, 265, 280
LmnI	GCTCC	2 cut(s)	47, 184
LpnPI	CCDG	3 cut(s)	58, 165, 281
LweI	GCATC	1 cut(s)	166
MaeI	CTAG	2 cut(s)	188, 215
MaeIII	GTNAC	1 cut(s)	298
MalI	GATC	3 cut(s)	198, 267, 282
MboI	GATC	3 cut(s)	196, 265, 280
MboII	GAAGA	4 cut(s)	191, 194, 275, 345
MflI	RGATCY	1 cut(s)	196
MhlI	GDGCHC	1 cut(s)	151
MluCI	AATT	1 cut(s)	71
MnlI	CCTC	2 cut(s)	135, 220
MslI	CAYNNNNRTG	1 cut(s)	162
MwoI	GCNNNNNNNGC	1 cut(s)	347
NdeII	GATC	3 cut(s)	196, 265, 280
NheI	GCTAGC	1 cut(s)	187
NlaIII	CATG	2 cut(s)	29, 167
PfeI	GAWTC	1 cut(s)	221
PsuI	RGATCY	1 cut(s)	196
RseI	CAYNNNNRTG	1 cut(s)	162
Sau3AI	GATC	3 cut(s)	196, 265, 280
SduI	GDGCHC	1 cut(s)	151
SetI	ASST	6 cut(s)	44, 123, 154, 189, 193, 212
SfaNI	GCATC	1 cut(s)	166
SmiMI	CAYNNNNRTG	1 cut(s)	162
SmlI	CTYRAG	1 cut(s)	192
SmoI	CTYRAG	1 cut(s)	192
Sse9I	AATT	1 cut(s)	71
SspMI	CTAG	2 cut(s)	188, 215
TaaI	ACNGT	1 cut(s)	109
TaqI	TCGA	1 cut(s)	114
TasI	AATT	1 cut(s)	71
TfiI	GAWTC	1 cut(s)	221
TscAI	CASTG	1 cut(s)	73
TspDTI	ATGAA	4 cut(s)	17, 213, 226, 257
TspGWI	ACGGA	1 cut(s)	197
TspRI	CASTG	1 cut(s)	73
VneI	GTGCAC	1 cut(s)	147
XspI	CTAG	2 cut(s)	188, 215

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.