Rw1G007200

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
15168448 .. 15168948
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G007200.1

Sequence Viewer

Length: 465 bp
ATGTCAGGACATCCTATCACCAAAATTCTCAATGAAAATCGTCTTGAGGGCCCAAACTTTAATGACTGGCTCCGCAATTTGAAAATTGTATTGACATTCGATAAGATCGCTTATGTCTTACAAAATGCACCCCCTCACACTCCTTTGGCTCAAGATGCAACTGATGAGAAACGTGTTGCTTATCAAAAGCATAAGGATGATGACACTCAAGCTAAATGTCAACATGAGAATATGGATAGCGCCAGTTCTATATTACTCCATCTCACTGAATTGTTTGGTGAAAGAAATAGAAATGTGCGCTTTACAGTAGTCAATGAGCTTGTCAAGACAAAACATGTGAGGGGTGCACCTGTGCATCAACATGGTCTAAAAATGATAAGCCTTATTGAGCAAATTCAAGACCTTGGATTTGCACTTGATGCGGAGCTAGCTAGCTCAAGATCTTCATCTAACCTCCCTAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.46

Weight (kDa)

7.1

Isoelectric Point (pI)

43.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 73, 422
AcsI RAATTY 2 cut(s) 24, 393
AflIII ACRYGT 2 cut(s) 172, 334
AgsI TTSAA 2 cut(s) 82, 398
AluBI AGCT 5 cut(s) 212, 319, 427, 431, 435
AluI AGCT 5 cut(s) 212, 319, 427, 431, 435
Alw21I GWGCWC 1 cut(s) 349
Alw44I GTGCAC 1 cut(s) 345
AoxI GGCC 1 cut(s) 49
ApaI GGGCCC 1 cut(s) 53
ApaLI GTGCAC 1 cut(s) 345
ApoI RAATTY 2 cut(s) 24, 393
ArsI GACNNNNNNTTYG 2 cut(s) 392, 424
AspLEI GCGC 2 cut(s) 242, 300
AspS9I GGNCC 2 cut(s) 49, 50
AsuHPI GGTGA 2 cut(s) 10, 290
AsuNHI GCTAGC 2 cut(s) 427, 431
BaeGI GKGCMC 2 cut(s) 53, 349
BanII GRGCYC 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 349
BccI CCATC 1 cut(s) 267
BfaI CTAG 3 cut(s) 428, 432, 459
BfoI RGCGCY 1 cut(s) 243
BglII AGATCT 1 cut(s) 440
BmgT120I GGNCC 2 cut(s) 49, 50
BmiI GGNNCC 2 cut(s) 51, 71
BmsI GCATC 3 cut(s) 145, 364, 409
BmtI GCTAGC 2 cut(s) 431, 435
BpuEI CTTGAG 4 cut(s) 65, 135, 192, 421
BsaBI GATNNNNATC 1 cut(s) 445
BsaJI CCNNGG 1 cut(s) 403
Bse1I ACTGG 2 cut(s) 71, 243
Bse8I GATNNNNATC 1 cut(s) 445
BseDI CCNNGG 1 cut(s) 403
BseGI GGATG 2 cut(s) 10, 202
BseJI GATNNNNATC 1 cut(s) 445
BseNI ACTGG 2 cut(s) 71, 243
BseSI GKGCMC 2 cut(s) 53, 349
BshFI GGCC 1 cut(s) 51
BsiHKAI GWGCWC 1 cut(s) 349
BsnI GGCC 1 cut(s) 51
Bsp120I GGGCCC 1 cut(s) 49
Bsp1286I GDGCHC 2 cut(s) 53, 349
Bsp143I GATC 2 cut(s) 105, 440
BspACI CCGC 2 cut(s) 73, 422
BspANI GGCC 1 cut(s) 51
BspLI GGNNCC 2 cut(s) 51, 71
BspOI GCTAGC 2 cut(s) 431, 435
BsrI ACTGG 2 cut(s) 71, 243
BssECI CCNNGG 1 cut(s) 403
BssMI GATC 2 cut(s) 105, 440
BssT1I CCWWGG 1 cut(s) 403
Bst4CI ACNGT 1 cut(s) 307
BstAPI GCANNNNNTGC 1 cut(s) 419
BstC8I GCNNGC 2 cut(s) 429, 433
BstF5I GGATG 2 cut(s) 10, 202
BstH2I RGCGCY 1 cut(s) 243
BstHHI GCGC 2 cut(s) 242, 300
BstKTI GATC 2 cut(s) 108, 443
BstMBI GATC 2 cut(s) 105, 440
BstMWI GCNNNNNNNGC 3 cut(s) 155, 419, 428
BstNSI RCATGY 1 cut(s) 338
BstSLI GKGCMC 2 cut(s) 53, 349
BstX2I RGATCY 1 cut(s) 440
BstYI RGATCY 1 cut(s) 440
BsuRI GGCC 1 cut(s) 51
BtsCI GGATG 2 cut(s) 10, 202
BtsIMutI CAGTG 1 cut(s) 264
Cac8I GCNNGC 2 cut(s) 429, 433
CfoI GCGC 2 cut(s) 242, 300
Cfr13I GGNCC 2 cut(s) 49, 50
CviAII CATG 3 cut(s) 224, 335, 362
CviJI RGCY 9 cut(s) 51, 70, 149, 212, 319, 381, 427, 431, 435
CviKI_1 RGCY 9 cut(s) 51, 70, 149, 212, 319, 381, 427, 431, 435
DpnI GATC 2 cut(s) 107, 442
DpnII GATC 2 cut(s) 105, 440
Eco130I CCWWGG 1 cut(s) 403
Eco24I GRGCYC 1 cut(s) 53
EcoO109I RGGNCCY 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 403
EcoT38I GRGCYC 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 403
FaeI CATG 3 cut(s) 227, 338, 365
FaiI YATR 7 cut(s) 114, 192, 225, 233, 251, 336, 363
FatI CATG 3 cut(s) 223, 334, 361
FokI GGATG 1 cut(s) 209
FriOI GRGCYC 1 cut(s) 53
FspBI CTAG 3 cut(s) 428, 432, 459
GlaI GCGC 2 cut(s) 241, 299
HaeII RGCGCY 1 cut(s) 243
HaeIII GGCC 1 cut(s) 51
HhaI GCGC 2 cut(s) 242, 300
Hin1II CATG 3 cut(s) 227, 338, 365
Hin6I GCGC 2 cut(s) 240, 298
HinP1I GCGC 2 cut(s) 240, 298
HincII GTYRAC 1 cut(s) 221
HindII GTYRAC 1 cut(s) 221
HphI GGTGA 2 cut(s) 10, 290
Hpy166II GTNNAC 2 cut(s) 221, 347
Hpy188III TCNNGA 6 cut(s) 6, 44, 152, 325, 398, 438
Hpy8I GTNNAC 2 cut(s) 221, 347
HpyCH4III ACNGT 1 cut(s) 307
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 5 cut(s) 128, 158, 347, 355, 413
HpyF10VI GCNNNNNNNGC 3 cut(s) 155, 419, 428
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 3 cut(s) 227, 338, 365
HspAI GCGC 2 cut(s) 240, 298
Kzo9I GATC 2 cut(s) 105, 440
LmnI GCTCC 2 cut(s) 75, 424
LpnPI CCDG 3 cut(s) 52, 256, 363
LweI GCATC 3 cut(s) 145, 364, 409
MaeI CTAG 3 cut(s) 428, 432, 459
MaeII ACGT 1 cut(s) 172
MalI GATC 2 cut(s) 107, 442
MboI GATC 2 cut(s) 105, 440
MboII GAAGA 1 cut(s) 435
MflI RGATCY 1 cut(s) 440
MhlI GDGCHC 2 cut(s) 53, 349
MluCI AATT 5 cut(s) 24, 76, 84, 269, 393
MnlI CCTC 4 cut(s) 40, 144, 333, 464
MseI TTAA 1 cut(s) 60
MslI CAYNNNNRTG 2 cut(s) 195, 360
MwoI GCNNNNNNNGC 3 cut(s) 155, 419, 428
NdeII GATC 2 cut(s) 105, 440
NheI GCTAGC 2 cut(s) 427, 431
NlaIII CATG 3 cut(s) 227, 338, 365
NlaIV GGNNCC 2 cut(s) 51, 71
NspI RCATGY 1 cut(s) 338
PciI ACATGT 1 cut(s) 334
PscI ACATGT 1 cut(s) 334
PspN4I GGNNCC 2 cut(s) 51, 71
PspOMI GGGCCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 49, 50
PsuI RGATCY 1 cut(s) 440
RseI CAYNNNNRTG 2 cut(s) 195, 360
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 2 cut(s) 105, 440
Sau96I GGNCC 2 cut(s) 49, 50
SduI GDGCHC 2 cut(s) 53, 349
SetI ASST 9 cut(s) 175, 214, 321, 352, 405, 429, 433, 437, 456
SfaNI GCATC 3 cut(s) 145, 364, 409
SmiMI CAYNNNNRTG 2 cut(s) 195, 360
SmlI CTYRAG 4 cut(s) 44, 150, 207, 436
SmoI CTYRAG 4 cut(s) 44, 150, 207, 436
Sse9I AATT 5 cut(s) 24, 76, 84, 269, 393
SsiI CCGC 2 cut(s) 73, 422
SspMI CTAG 3 cut(s) 428, 432, 459
StyI CCWWGG 1 cut(s) 403
TaaI ACNGT 1 cut(s) 307
TaiI ACGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 99
TasI AATT 5 cut(s) 24, 76, 84, 269, 393
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TscAI CASTG 1 cut(s) 271
TspDTI ATGAA 2 cut(s) 48, 435
TspRI CASTG 1 cut(s) 271
VneI GTGCAC 1 cut(s) 345
XapI RAATTY 2 cut(s) 24, 393
XceI RCATGY 1 cut(s) 338
XspI CTAG 3 cut(s) 428, 432, 459
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.