Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr1C

Orthogroup ID

OG0002402

Physical Location & Seq

Genomic Coordinates Forward (+)

30150052 .. 30150361

Gene Structure 310 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh1CG138000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 310 bp

ATGAACTATAATATGCAACAAATGGATCATACTCTTCCTGATCTTCTCAATATACTGGTAACATCTGAGAAGCAAATTAAGAAAGAAAGTGGGAGTGTGGCCATTGTCGCTTCTTCTTCCACCAAGTCCAAAGGCAAGGGCAAAGGGAAGAAGAAGCAAGTGGCAAAGCCTAAAGGAGCAGTCCAAAAGAAGAAGAAGAAGGAACAAAAGGAACCAAAAGGTCTTTGTTTCTTTTGCAACACGGATGGGCATTGGAAAAGGAATTGCAAAGCTTATCTTGCATCCTTGAAGAACAAGACTTCAACAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

103

Amino Acids

11.46

Weight (kDa)

10.05

Isoelectric Point (pI)

26.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002402)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g29991
malus_domestica	MD00G1044200.v1.1
prunus_persica	Prupe.2G062600_v2.0.a1 Prupe.2G064700_v2.0.a1 Prupe.6G167800_v2.0.a1
pyrus_communis	pycom13g29530 pycom17g02500 pycom39g00040 pycom976g00080
rosa_chinensis	RchiOBHm_Chr1g0376911 RchiOBHm_Chr1g0379561 RchiOBHm_Chr2g0165661 RchiOBHm_Chr2g0176521
rosa_multiflora	Rmu_sc0000070.1_g000011 Rmu_sc0000555.1_g000020 Rmu_sc0001291.1_g000051 Rmu_sc0001306.1_g000003 Rmu_sc0005142.1_g000016 Rmu_ssc0000389.1_g000014
rosa_roxburghii	Rroxscaffold_2G00096870 Rroxscaffold_5G00384810 Rroxscaffold_6G00394930
rosa_samantha	Rh1CG138000 Rh1CG192400 Rh7BG220700
rosa_wichuraiana	Rw0G002230 Rw0G012080 Rw1G007200 Rw1G008660 Rw1G011890 Rw2G018430 Rw3G008190 Rw3G020340 Rw3G024460 Rw4G000210 Rw5G007300 Rw5G015820 Rw5G032410 Rw5G048130 Rw5G049610 Rw7G025770 Rw7G028470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	33
AcoI	YGGCCR	1 cut(s)	99
AgsI	TTSAA	2 cut(s)	289, 303
AluBI	AGCT	1 cut(s)	272
AluI	AGCT	1 cut(s)	272
AlwI	GGATC	1 cut(s)	33
AoxI	GGCC	1 cut(s)	99
BalI	TGGCCA	1 cut(s)	101
BccI	CCATC	1 cut(s)	239
BmiI	GGNNCC	1 cut(s)	213
BmsI	GCATC	1 cut(s)	290
Bse1I	ACTGG	1 cut(s)	60
BseGI	GGATG	2 cut(s)	250, 281
BseMII	CTCAG	1 cut(s)	57
BseNI	ACTGG	1 cut(s)	60
BshFI	GGCC	1 cut(s)	101
BsnI	GGCC	1 cut(s)	101
Bsp143I	GATC	2 cut(s)	25, 40
BspANI	GGCC	1 cut(s)	101
BspCNI	CTCAG	1 cut(s)	58
BspLI	GGNNCC	1 cut(s)	213
BspPI	GGATC	1 cut(s)	33
BsrI	ACTGG	1 cut(s)	60
BssMI	GATC	2 cut(s)	25, 40
Bst4CI	ACNGT	1 cut(s)	307
Bst6I	CTCTTC	1 cut(s)	39
BstDEI	CTNAG	1 cut(s)	66
BstF5I	GGATG	2 cut(s)	250, 281
BstKTI	GATC	2 cut(s)	28, 43
BstMBI	GATC	2 cut(s)	25, 40
BstMWI	GCNNNNNNNGC	2 cut(s)	107, 278
BsuRI	GGCC	1 cut(s)	101
BtsCI	GGATG	2 cut(s)	250, 281
CviJI	RGCY	3 cut(s)	101, 169, 272
CviKI_1	RGCY	3 cut(s)	101, 169, 272
DdeI	CTNAG	1 cut(s)	66
DpnI	GATC	2 cut(s)	27, 42
DpnII	GATC	2 cut(s)	25, 40
EaeI	YGGCCR	1 cut(s)	99
Eam1104I	CTCTTC	1 cut(s)	39
EarI	CTCTTC	1 cut(s)	39
FaiI	YATR	4 cut(s)	9, 14, 30, 53
FalI	AAGNNNNNCTT	2 cut(s)	261, 293
FokI	GGATG	2 cut(s)	257, 268
HaeIII	GGCC	1 cut(s)	101
HindIII	AAGCTT	1 cut(s)	270
Hpy188I	TCNGA	1 cut(s)	67
Hpy188III	TCNNGA	1 cut(s)	38
HpyAV	CCTTC	1 cut(s)	193
HpyCH4III	ACNGT	1 cut(s)	307
HpyCH4V	TGCA	4 cut(s)	16, 237, 267, 281
HpyF10VI	GCNNNNNNNGC	2 cut(s)	107, 278
HpyF3I	CTNAG	1 cut(s)	66
Kzo9I	GATC	2 cut(s)	25, 40
LmnI	GCTCC	1 cut(s)	176
LpnPI	CCDG	2 cut(s)	41, 51
LweI	GCATC	1 cut(s)	290
MaeIII	GTNAC	1 cut(s)	58
MalI	GATC	2 cut(s)	27, 42
MboI	GATC	2 cut(s)	25, 40
MlsI	TGGCCA	1 cut(s)	101
MluCI	AATT	2 cut(s)	75, 262
MluNI	TGGCCA	1 cut(s)	101
Mox20I	TGGCCA	1 cut(s)	101
MscI	TGGCCA	1 cut(s)	101
MseI	TTAA	1 cut(s)	78
Msp20I	TGGCCA	1 cut(s)	101
MwoI	GCNNNNNNNGC	2 cut(s)	107, 278
NdeII	GATC	2 cut(s)	25, 40
NlaIV	GGNNCC	1 cut(s)	213
PspN4I	GGNNCC	1 cut(s)	213
SaqAI	TTAA	1 cut(s)	78
Sau3AI	GATC	2 cut(s)	25, 40
SetI	ASST	2 cut(s)	223, 274
SfaNI	GCATC	1 cut(s)	290
SgeI	CNNG	8 cut(s)	50, 68, 136, 148, 170, 253, 290, 298
Sse9I	AATT	2 cut(s)	75, 262
TaaI	ACNGT	1 cut(s)	307
TasI	AATT	2 cut(s)	75, 262
Tru1I	TTAA	1 cut(s)	78
Tru9I	TTAA	1 cut(s)	78
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	257

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.