RchiOBHm_Chr2g0170001

Paired amphipathic helix protein Sin3-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
84057270 .. 84057639
370 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGGCTGATGGGCACCTTGTTGGAGATGGCTGTTCTTTGCAATTGCCAGAACGTTATCTTATGTCTGTGAAGCCTCTTGCAAAGCATGTATCGGTACCTTTAGTTGACGAAAAGAAAGACTCTCGTGTTTTTTATGGAAATGATTACTTCTATGTGCTCTATAGGCTTCATCAATGCTAG

Protein Analysis

59

Amino Acids

6.8

Weight (kDa)

6.81

Isoelectric Point (pI)

36.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 94
AccB1I GGYRCC 2 cut(s) 12, 94
AclI AACGTT 1 cut(s) 52
AfaI GTAC 1 cut(s) 96
Alw21I GWGCWC 1 cut(s) 159
Asp718I GGTACC 1 cut(s) 94
BaeGI GKGCMC 1 cut(s) 15
BanI GGYRCC 2 cut(s) 12, 94
BauI CACGAG 1 cut(s) 123
Bbv12I GWGCWC 1 cut(s) 159
BccI CCATC 2 cut(s) 2, 20
BfaI CTAG 1 cut(s) 178
BfmI CTRYAG 1 cut(s) 160
BmiI GGNNCC 2 cut(s) 14, 96
BseSI GKGCMC 1 cut(s) 15
BshNI GGYRCC 2 cut(s) 12, 94
BsiHKAI GWGCWC 1 cut(s) 159
Bsp1286I GDGCHC 2 cut(s) 15, 159
BspLI GGNNCC 2 cut(s) 14, 96
BspT107I GGYRCC 2 cut(s) 12, 94
BssSI CACGAG 1 cut(s) 123
Bst2BI CACGAG 1 cut(s) 123
BstMWI GCNNNNNNNGC 1 cut(s) 163
BstNSI RCATGY 1 cut(s) 89
BstSFI CTRYAG 1 cut(s) 160
BstSLI GKGCMC 1 cut(s) 15
Csp6I GTAC 1 cut(s) 95
CviAII CATG 1 cut(s) 86
CviJI RGCY 4 cut(s) 5, 30, 73, 166
CviKI_1 RGCY 4 cut(s) 5, 30, 73, 166
CviQI GTAC 1 cut(s) 95
FaeI CATG 1 cut(s) 89
FaiI YATR 5 cut(s) 62, 87, 135, 153, 162
FatI CATG 1 cut(s) 85
FspBI CTAG 1 cut(s) 178
FspEI CC 9 cut(s) 6, 12, 29, 60, 77, 87, 111, 120, 148
Hin1II CATG 1 cut(s) 89
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HinfI GANTC 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 106
Hpy8I GTNNAC 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 40, 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
HpySE526I ACGT 1 cut(s) 52
Hsp92II CATG 1 cut(s) 89
KpnI GGTACC 1 cut(s) 98
LpnPI CCDG 1 cut(s) 60
MaeI CTAG 1 cut(s) 178
MaeII ACGT 1 cut(s) 52
MfeI CAATTG 1 cut(s) 41
MhlI GDGCHC 2 cut(s) 15, 159
MluCI AATT 1 cut(s) 41
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 1 cut(s) 84
MunI CAATTG 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 163
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 2 cut(s) 14, 96
NspI RCATGY 1 cut(s) 89
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
Psp1406I AACGTT 1 cut(s) 52
PspN4I GGNNCC 2 cut(s) 14, 96
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
SchI GAGTC 1 cut(s) 113
SduI GDGCHC 2 cut(s) 15, 159
SetI ASST 3 cut(s) 18, 55, 100
SfcI CTRYAG 1 cut(s) 160
SgeI CNNG 6 cut(s) 29, 59, 89, 98, 135, 137
Sse9I AATT 1 cut(s) 41
SspMI CTAG 1 cut(s) 178
TaiI ACGT 1 cut(s) 55
TasI AATT 1 cut(s) 41
TspDTI ATGAA 1 cut(s) 158
XceI RCATGY 1 cut(s) 89
XspI CTAG 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.