RchiOBHm_Chr1g0341961

Belongs to the TBCA family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0003164
Physical Location & Seq
Reverse (-)
33848768 .. 33848935
168 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGGGTGATATGGCAACTCTAAGGAAACTGAAAATCAAGACTGGCACTTGTAAACGCCTCGTTAAGGAGTTTCATTCTTGTGAGAAAGAGGTTGAGGGAGAGGCTGCGAAGACAGCAGACATGAAGGGGAAAGGAGCTGATCCTTATGACCTCAAGCAACAGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TBCA

Protein Analysis

55

Amino Acids

6.11

Weight (kDa)

9.0

Isoelectric Point (pI)

16.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TBCA PF02970 6 - 54 7.5e-15 Tubulin binding cofactor A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 64
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AlwI GGATC 1 cut(s) 134
ApeKI GCWGC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 116
BbvI GCAGC 1 cut(s) 91
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 137
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 64
BseNI ACTGG 1 cut(s) 46
BseXI GCAGC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 1 cut(s) 139
BspPI GGATC 1 cut(s) 134
BsrI ACTGG 1 cut(s) 46
BssMI GATC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 20
BstENI CCTNNNNNAGG 1 cut(s) 62
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstV1I GCAGC 1 cut(s) 91
BstV2I GAAGAC 1 cut(s) 116
CviAII CATG 1 cut(s) 121
CviJI RGCY 2 cut(s) 104, 137
CviKI_1 RGCY 2 cut(s) 104, 137
DdeI CTNAG 1 cut(s) 20
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
EcoNI CCTNNNNNAGG 1 cut(s) 62
FaeI CATG 1 cut(s) 124
FaiI YATR 4 cut(s) 11, 122, 147, 166
FatI CATG 1 cut(s) 120
Fnu4HI GCNGC 1 cut(s) 105
Fsp4HI GCNGC 1 cut(s) 105
GluI GCNGC 1 cut(s) 105
Hin1II CATG 1 cut(s) 124
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 53
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 118
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 20
Hsp92II CATG 1 cut(s) 124
Kzo9I GATC 1 cut(s) 139
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 2 cut(s) 27, 146
Lsp1109I GCAGC 1 cut(s) 91
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 121
MnlI CCTC 5 cut(s) 68, 82, 88, 94, 161
MseI TTAA 1 cut(s) 63
MslI CAYNNNNRTG 1 cut(s) 78
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 1 cut(s) 139
NlaIII CATG 1 cut(s) 124
PkrI GCNGC 1 cut(s) 106
RseI CAYNNNNRTG 1 cut(s) 78
SaqAI TTAA 1 cut(s) 63
SatI GCNGC 1 cut(s) 105
Sau3AI GATC 1 cut(s) 139
SetI ASST 4 cut(s) 93, 139, 153, 165
SgeI CNNG 6 cut(s) 49, 54, 60, 71, 90, 133
SmiMI CAYNNNNRTG 1 cut(s) 78
SmlI CTYRAG 1 cut(s) 152
SmoI CTYRAG 1 cut(s) 152
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TseI GCWGC 1 cut(s) 104
TspDTI ATGAA 2 cut(s) 62, 137
XagI CCTNNNNNAGG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.