RchiOBHm_Chr1g0379561

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
65599926 .. 65600492
567 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGAACTATAATATGCAACAAATGGATCATACTCTTTCTGATCTTCTCAATATGCTGGTAACAGCTGAGAAGCAAATTAAGAAAGAGAGTGGGAGTGCGGCTATTATCGCTTCTTCTTCATCCAGTAAGTCCAAATGTAAAGGCAAAGGGAAGAAGAAACAAGTGATAAAGCCTAAGGGAGTAGTCCAAAAGAAGAAGAAGAAGGAACAAAAGGAACCAAAAGGTATTTGTTTCTTTTGCAACAAAGATGGGCACTGGAAGAGGAATTGCAAAGCTTATCTTGCATCCTTGAAGAACAAGTCTTCAACGGAAGGACCTAGTGGGAGCAAGGAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.38

Weight (kDa)

9.93

Isoelectric Point (pI)

29.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 98
AclWI GGATC 1 cut(s) 33
AgsI TTSAA 2 cut(s) 292, 306
AluBI AGCT 3 cut(s) 65, 275, 335
AluI AGCT 3 cut(s) 65, 275, 335
AlwI GGATC 1 cut(s) 33
AspS9I GGNCC 1 cut(s) 314
AvaII GGWCC 1 cut(s) 314
AxyI CCTNAGG 1 cut(s) 174
BaeGI GKGCMC 1 cut(s) 255
BbsI GAAGAC 1 cut(s) 294
BccI CCATC 1 cut(s) 242
BfaI CTAG 1 cut(s) 318
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
Bme18I GGWCC 1 cut(s) 314
BmgT120I GGNCC 1 cut(s) 314
BmiI GGNNCC 1 cut(s) 216
BmsI GCATC 1 cut(s) 293
BpiI GAAGAC 1 cut(s) 294
Bse1I ACTGG 2 cut(s) 123, 260
Bse21I CCTNAGG 1 cut(s) 174
BseGI GGATG 2 cut(s) 119, 284
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 2 cut(s) 123, 260
BseSI GKGCMC 1 cut(s) 255
Bsp1286I GDGCHC 1 cut(s) 255
Bsp143I GATC 2 cut(s) 25, 40
BspACI CCGC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 216
BspPI GGATC 1 cut(s) 33
BsrI ACTGG 2 cut(s) 123, 260
BssMI GATC 2 cut(s) 25, 40
Bst6I CTCTTC 1 cut(s) 254
BstDEI CTNAG 2 cut(s) 66, 174
BstF5I GGATG 2 cut(s) 119, 284
BstKTI GATC 2 cut(s) 28, 43
BstMBI GATC 2 cut(s) 25, 40
BstMWI GCNNNNNNNGC 2 cut(s) 107, 281
BstSLI GKGCMC 1 cut(s) 255
BstV2I GAAGAC 1 cut(s) 294
Bsu36I CCTNAGG 1 cut(s) 174
BtsCI GGATG 2 cut(s) 119, 284
BtsIMutI CAGTG 1 cut(s) 253
Cfr13I GGNCC 1 cut(s) 314
CviJI RGCY 5 cut(s) 65, 101, 172, 275, 335
CviKI_1 RGCY 5 cut(s) 65, 101, 172, 275, 335
DdeI CTNAG 2 cut(s) 66, 174
DpnI GATC 2 cut(s) 27, 42
DpnII GATC 2 cut(s) 25, 40
Eam1104I CTCTTC 1 cut(s) 254
EarI CTCTTC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 314
Eco81I CCTNAGG 1 cut(s) 174
EcoO109I RGGNCCY 1 cut(s) 314
FaiI YATR 4 cut(s) 9, 14, 30, 53
FalI AAGNNNNNCTT 2 cut(s) 264, 296
Fnu4HI GCNGC 1 cut(s) 99
FokI GGATG 2 cut(s) 106, 271
Fsp4HI GCNGC 1 cut(s) 99
FspBI CTAG 1 cut(s) 318
GluI GCNGC 1 cut(s) 99
HindIII AAGCTT 2 cut(s) 273, 333
Hpy188I TCNGA 1 cut(s) 40
HpyAV CCTTC 2 cut(s) 196, 305
HpyCH4V TGCA 4 cut(s) 16, 240, 270, 284
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 281
HpyF3I CTNAG 2 cut(s) 66, 174
Kzo9I GATC 2 cut(s) 25, 40
LmnI GCTCC 1 cut(s) 324
LpnPI CCDG 3 cut(s) 41, 136, 241
LweI GCATC 1 cut(s) 293
MaeI CTAG 1 cut(s) 318
MaeIII GTNAC 1 cut(s) 58
MalI GATC 2 cut(s) 27, 42
MboI GATC 2 cut(s) 25, 40
MhlI GDGCHC 1 cut(s) 255
MluCI AATT 2 cut(s) 75, 265
MnlI CCTC 1 cut(s) 255
MseI TTAA 2 cut(s) 78, 337
MspA1I CMGCKG 1 cut(s) 65
MwoI GCNNNNNNNGC 2 cut(s) 107, 281
NdeII GATC 2 cut(s) 25, 40
NlaIV GGNNCC 1 cut(s) 216
PkrI GCNGC 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 314
Psp5II RGGWCCY 1 cut(s) 314
PspN4I GGNNCC 1 cut(s) 216
PspPI GGNCC 1 cut(s) 314
PspPPI RGGWCCY 1 cut(s) 314
PvuII CAGCTG 1 cut(s) 65
SaqAI TTAA 2 cut(s) 78, 337
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 2 cut(s) 25, 40
Sau96I GGNCC 1 cut(s) 314
SduI GDGCHC 1 cut(s) 255
SetI ASST 5 cut(s) 67, 226, 277, 319, 337
SfaNI GCATC 1 cut(s) 293
SgeI CNNG 8 cut(s) 68, 135, 173, 268, 293, 301, 310, 330
SinI GGWCC 1 cut(s) 314
Sse9I AATT 2 cut(s) 75, 265
SsiI CCGC 1 cut(s) 98
SspMI CTAG 1 cut(s) 318
TasI AATT 2 cut(s) 75, 265
TauI GCSGC 1 cut(s) 101
Tru1I TTAA 2 cut(s) 78, 337
Tru9I TTAA 2 cut(s) 78, 337
TscAI CASTG 1 cut(s) 260
TspDTI ATGAA 2 cut(s) 17, 108
TspGWI ACGGA 1 cut(s) 323
TspRI CASTG 1 cut(s) 260
VpaK11BI GGWCC 1 cut(s) 314
XspI CTAG 1 cut(s) 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.