RchiOBHm_Chr1g0325421

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
13404799 .. 13405409
611 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55515

Sequence Viewer

Length: 129 bp
ATGAGAGAACTAAGATGTGCTCATTTCTTTCATAAAGATTGCTTGTACCATTTGACAGGAAATAAGCGGAATTGCGGAAATGATGTAAAATTAGAGCTAGTTGGAGTTTCCGAGAAAGAGACGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.92

Weight (kDa)

8.57

Isoelectric Point (pI)

30.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 67, 75
AfaI GTAC 1 cut(s) 47
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw21I GWGCWC 1 cut(s) 22
Alw26I GTCTC 1 cut(s) 113
Bbv12I GWGCWC 1 cut(s) 22
BcoDI GTCTC 1 cut(s) 113
BfaI CTAG 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 113
BsmBI CGTCTC 1 cut(s) 113
Bsp1286I GDGCHC 1 cut(s) 22
BspACI CCGC 2 cut(s) 67, 75
BstDEI CTNAG 1 cut(s) 11
BstMAI GTCTC 1 cut(s) 113
Csp6I GTAC 1 cut(s) 46
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 11
Esp3I CGTCTC 1 cut(s) 113
FaiI YATR 1 cut(s) 33
FspBI CTAG 1 cut(s) 98
FspEI CC 6 cut(s) 42, 52, 60, 62, 87, 124
Hpy188I TCNGA 1 cut(s) 112
HpyF3I CTNAG 1 cut(s) 11
LpnPI CCDG 1 cut(s) 42
MaeI CTAG 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 2 cut(s) 70, 89
MmeI TCCRAC 1 cut(s) 82
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SduI GDGCHC 1 cut(s) 22
SetI ASST 1 cut(s) 99
SgeI CNNG 4 cut(s) 55, 69, 110, 124
Sse9I AATT 2 cut(s) 70, 89
SsiI CCGC 2 cut(s) 67, 75
SspMI CTAG 1 cut(s) 98
TasI AATT 2 cut(s) 70, 89
TspDTI ATGAA 1 cut(s) 20
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.