RchiOBHm_Chr1g0330911

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
20648438 .. 20659477
11040 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55999

Sequence Viewer

Length: 204 bp
ATGAGTGCAACTCAGCCTCCAAAAACACGCTCTCACAGCTCTGTATGGCCAATTGCTGTGGCTAAAGAGGCTCATCTTACCCCACAAGCAAAACGTTCGATGCACGAAAAGACTGCTCCAAGGAGCATCTTACATCAGTTCTTAATCTTAAAGATGAGGTATCCATTGCTACTGCTGGAGCTGTGGACAGGGCCTGAACCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.65

Weight (kDa)

10.28

Isoelectric Point (pI)

73.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 94
AcoI YGGCCR 1 cut(s) 47
AluBI AGCT 2 cut(s) 39, 181
AluI AGCT 2 cut(s) 39, 181
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 2 cut(s) 47, 191
AspS9I GGNCC 1 cut(s) 191
BalI TGGCCA 1 cut(s) 49
BcgI CGANNNNNNTGC 4 cut(s) 78, 95, 112, 129
BciVI GTATCC 1 cut(s) 171
BfuI GTATCC 1 cut(s) 171
BmgT120I GGNCC 1 cut(s) 191
BmsI GCATC 2 cut(s) 90, 135
BplI GAGNNNNNCTC 1 cut(s) 27
BpmI CTGGAG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 119
BsaXI ACNNNNNCTCC 1 cut(s) 31
Bse3DI GCAATG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 26
BshFI GGCC 2 cut(s) 49, 193
BsnI GGCC 2 cut(s) 49, 193
BspANI GGCC 2 cut(s) 49, 193
BspCNI CTCAG 1 cut(s) 25
BsrDI GCAATG 1 cut(s) 164
BssECI CCNNGG 1 cut(s) 119
BssT1I CCWWGG 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 12
BstMWI GCNNNNNNNGC 2 cut(s) 36, 68
BsuI GTATCC 1 cut(s) 171
BsuRI GGCC 2 cut(s) 49, 193
CaiI CAGNNNCTG 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 191
CspCI CAANNNNNGTGG 2 cut(s) 39, 74
CviJI RGCY 7 cut(s) 16, 39, 49, 62, 71, 181, 193
CviKI_1 RGCY 7 cut(s) 16, 39, 49, 62, 71, 181, 193
DdeI CTNAG 1 cut(s) 12
EaeI YGGCCR 1 cut(s) 47
Eco130I CCWWGG 1 cut(s) 119
EcoO109I RGGNCCY 1 cut(s) 191
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaiI YATR 2 cut(s) 46, 202
GsuI CTGGAG 1 cut(s) 197
HaeIII GGCC 2 cut(s) 49, 193
Hpy166II GTNNAC 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 186
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 8, 103
HpyF10VI GCNNNNNNNGC 2 cut(s) 36, 68
HpyF3I CTNAG 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 94
LmnI GCTCC 3 cut(s) 121, 123, 178
LpnPI CCDG 2 cut(s) 161, 174
LweI GCATC 2 cut(s) 90, 135
MaeII ACGT 1 cut(s) 94
MfeI CAATTG 1 cut(s) 51
MlsI TGGCCA 1 cut(s) 49
MluCI AATT 1 cut(s) 51
MluNI TGGCCA 1 cut(s) 49
MnlI CCTC 3 cut(s) 27, 61, 150
Mox20I TGGCCA 1 cut(s) 49
MscI TGGCCA 1 cut(s) 49
MseI TTAA 2 cut(s) 143, 149
Msp20I TGGCCA 1 cut(s) 49
MunI CAATTG 1 cut(s) 51
MwoI GCNNNNNNNGC 2 cut(s) 36, 68
Psp1406I AACGTT 1 cut(s) 94
PspPI GGNCC 1 cut(s) 191
PstNI CAGNNNCTG 1 cut(s) 194
SaqAI TTAA 2 cut(s) 143, 149
Sau96I GGNCC 1 cut(s) 191
SetI ASST 4 cut(s) 41, 97, 161, 183
SfaNI GCATC 2 cut(s) 90, 135
SgeI CNNG 5 cut(s) 39, 98, 116, 132, 188
Sse9I AATT 1 cut(s) 51
StyI CCWWGG 1 cut(s) 119
TaiI ACGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 98
TasI AATT 1 cut(s) 51
Tru1I TTAA 2 cut(s) 143, 149
Tru9I TTAA 2 cut(s) 143, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.