Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000369.1

Orthogroup ID

OG0002207

Physical Location & Seq

Genomic Coordinates Reverse (-)

38613 .. 39005

Gene Structure 393 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000369.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 393 bp

atggatccagagtatcagagaattggcacaattagacccaaatcggatttatacgcatttggggtcattatcctccaagtattgacagcacggcatccaaataggcttatagacattgtggaaaatgcaattgcaaatggttcttttgccgactttttagatgagtcagtcacagatggaccactagaagaaacagaggagttggctcaactagcattaaggtgttcaaagcttagatgcagggatcgaccagatcttgaaactgaagtagttctgccagttctcaaaagactcgttgatattgcagatcctagttctaagattgagagaaaccattttgatgcaccaagccactactattgtccaatacttcaggtaaagtattgcgagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr U-box Usp

Protein Analysis

130

Amino Acids

14.81

Weight (kDa)

4.95

Isoelectric Point (pI)

48.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002207)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G19410 AT2G19410 AT2G19410 AT5G57035
fragaria_vesca	FvH4_1g07970 FvH4_1g07970 FvH4_1g07970 FvH4_1g07970 FvH4_1g07970
malus_domestica	MD02G1084100.v1.1
prunus_persica	Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1
pyrus_communis	pycom02g06680 pycom02g06690
rosa_chinensis	RchiOBHm_Chr1g0330911 RchiOBHm_Chr2g0093881 RchiOBHm_Chr2g0094001 RchiOBHm_Chr7g0232521
rosa_laevigata	RLG00000001329 RLG00000016442 RLG00000016444
rosa_multiflora	Rmu_sc0003027.1_g000005 Rmu_sc0017523.1_g000016 Rmu_ssc0000369.1_g000008
rosa_roxburghii	Rroxscaffold_2G00147570 Rroxscaffold_2G00147700
rosa_rugosa	Rorug02G0040200 Rorug02G0040300
rosa_samantha	Rh2AG086900 Rh2AG087700 Rh2BG087700 Rh2CG090000 Rh2DG085600 Rh2DG086700 Rh2DG086800 Rh3CG371600 Rh7CG448000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	12, 252, 302
AcuI	CTGAAG	2 cut(s)	285, 356
AgsI	TTSAA	2 cut(s)	228, 260
AluBI	AGCT	1 cut(s)	232
AluI	AGCT	1 cut(s)	232
AlwI	GGATC	3 cut(s)	12, 252, 302
Asp700I	GAANNNNTTC	1 cut(s)	270
AspS9I	GGNCC	1 cut(s)	179
AvaII	GGWCC	1 cut(s)	179
BamHI	GGATCC	1 cut(s)	4
BccI	CCATC	1 cut(s)	170
BceAI	ACGGC	1 cut(s)	107
BfaI	CTAG	3 cut(s)	185, 212, 312
BglII	AGATCT	1 cut(s)	253
Bme18I	GGWCC	1 cut(s)	179
BmgT120I	GGNCC	1 cut(s)	179
BmiI	GGNNCC	1 cut(s)	6
BmsI	GCATC	3 cut(s)	103, 227, 331
Bse1I	ACTGG	1 cut(s)	278
BseGI	GGATG	1 cut(s)	94
BseNI	ACTGG	1 cut(s)	278
BseRI	GAGGAG	1 cut(s)	212
Bsp143I	GATC	4 cut(s)	4, 244, 253, 307
BspLI	GGNNCC	1 cut(s)	6
BspPI	GGATC	3 cut(s)	12, 252, 302
BsrI	ACTGG	1 cut(s)	278
BssMI	GATC	4 cut(s)	4, 244, 253, 307
BstDEI	CTNAG	2 cut(s)	233, 318
BstF5I	GGATG	1 cut(s)	94
BstKTI	GATC	4 cut(s)	7, 247, 256, 310
BstMBI	GATC	4 cut(s)	4, 244, 253, 307
BstMWI	GCNNNNNNNGC	1 cut(s)	212
BstX2I	RGATCY	3 cut(s)	4, 253, 307
BstYI	RGATCY	3 cut(s)	4, 253, 307
BtsCI	GGATG	1 cut(s)	94
Cfr13I	GGNCC	1 cut(s)	179
CspCI	CAANNNNNGTGG	2 cut(s)	341, 376
CviJI	RGCY	4 cut(s)	106, 206, 232, 351
CviKI_1	RGCY	4 cut(s)	106, 206, 232, 351
DdeI	CTNAG	2 cut(s)	233, 318
DpnI	GATC	4 cut(s)	6, 246, 255, 309
DpnII	GATC	4 cut(s)	4, 244, 253, 307
Eco47I	GGWCC	1 cut(s)	179
Eco57I	CTGAAG	2 cut(s)	285, 356
FaiI	YATR	2 cut(s)	52, 110
FokI	GGATG	1 cut(s)	81
FspBI	CTAG	3 cut(s)	185, 212, 312
HindIII	AAGCTT	1 cut(s)	230
HinfI	GANTC	2 cut(s)	164, 291
Hpy188I	TCNGA	2 cut(s)	18, 46
Hpy188III	TCNNGA	2 cut(s)	8, 257
HpyCH4V	TGCA	5 cut(s)	128, 134, 240, 305, 344
HpyF10VI	GCNNNNNNNGC	1 cut(s)	212
HpyF3I	CTNAG	2 cut(s)	233, 318
Kzo9I	GATC	4 cut(s)	4, 244, 253, 307
LpnPI	CCDG	5 cut(s)	21, 226, 264, 291, 359
LweI	GCATC	3 cut(s)	103, 227, 331
MaeI	CTAG	3 cut(s)	185, 212, 312
MaeIII	GTNAC	1 cut(s)	169
MalI	GATC	4 cut(s)	6, 246, 255, 309
MboI	GATC	4 cut(s)	4, 244, 253, 307
MboII	GAAGA	1 cut(s)	200
MfeI	CAATTG	1 cut(s)	129
MflI	RGATCY	3 cut(s)	4, 253, 307
MluCI	AATT	3 cut(s)	21, 30, 129
MlyI	GAGTC	2 cut(s)	173, 285
MnlI	CCTC	2 cut(s)	83, 190
MroXI	GAANNNNTTC	1 cut(s)	270
MseI	TTAA	1 cut(s)	218
MslI	CAYNNNNRTG	2 cut(s)	220, 339
MunI	CAATTG	1 cut(s)	129
MwoI	GCNNNNNNNGC	1 cut(s)	212
NdeII	GATC	4 cut(s)	4, 244, 253, 307
NlaIV	GGNNCC	1 cut(s)	6
NmuCI	GTSAC	1 cut(s)	169
PdmI	GAANNNNTTC	1 cut(s)	270
PleI	GAGTC	2 cut(s)	172, 285
PpsI	GAGTC	2 cut(s)	172, 285
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	1 cut(s)	179
PsuI	RGATCY	3 cut(s)	4, 253, 307
RseI	CAYNNNNRTG	2 cut(s)	220, 339
SaqAI	TTAA	1 cut(s)	218
Sau3AI	GATC	4 cut(s)	4, 244, 253, 307
Sau96I	GGNCC	1 cut(s)	179
SchI	GAGTC	2 cut(s)	173, 285
SetI	ASST	3 cut(s)	224, 234, 378
SfaNI	GCATC	3 cut(s)	103, 227, 331
SinI	GGWCC	1 cut(s)	179
SmiMI	CAYNNNNRTG	2 cut(s)	220, 339
Sse9I	AATT	3 cut(s)	21, 30, 129
SspMI	CTAG	3 cut(s)	185, 212, 312
TaqI	TCGA	1 cut(s)	247
TasI	AATT	3 cut(s)	21, 30, 129
Tru1I	TTAA	1 cut(s)	218
Tru9I	TTAA	1 cut(s)	218
TseFI	GTSAC	1 cut(s)	169
Tsp45I	GTSAC	1 cut(s)	169
VpaK11BI	GGWCC	1 cut(s)	179
XmnI	GAANNNNTTC	1 cut(s)	270
XspI	CTAG	3 cut(s)	185, 212, 312

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.