Rh2DG086800

U-box domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0002207
Physical Location & Seq
Forward (+)
6736006 .. 6736299
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG086800.1

Sequence Viewer

Length: 294 bp
ATGGACGACCCACACATTTCTGCCGATGGCTTTACTTATGAGTACAGAGCAATCAAAGCATGGCTTGACAAACACAATGTATCCCCATTGACAAGGCTTAGACTTCAGCATTCAGAGTTAACTCCTAACCATACATTGCGTTCAGCTATACAAGAATGGAGGTCAAGCGTGACATACTCTACTGCCTTAGTGGATAGACGAGTTGATTGCACCAGTTCTTGCAAGCTCTCCAAAGCAGAAACTACATATCAGGAGTATAGTTGTCTTATATTTTTAACTTGGATGCTCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr U-box Usp

Protein Analysis

97

Amino Acids

11.36

Weight (kDa)

7.76

Isoelectric Point (pI)

56.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
U-box PF04564 1 - 55 3.4e-13 U-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 89
AfaI GTAC 1 cut(s) 44
AluBI AGCT 2 cut(s) 146, 226
AluI AGCT 2 cut(s) 146, 226
BccI CCATC 1 cut(s) 20
BcgI CGANNNNNNTGC 2 cut(s) 189, 223
BciVI GTATCC 1 cut(s) 91
BfuI GTATCC 1 cut(s) 91
BmsI GCATC 1 cut(s) 273
Bse1I ACTGG 1 cut(s) 213
Bse3DI GCAATG 1 cut(s) 134
BseGI GGATG 1 cut(s) 288
BseMI GCAATG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 213
BsmI GAATGC 1 cut(s) 109
BsrDI GCAATG 1 cut(s) 134
BsrI ACTGG 1 cut(s) 213
BstC8I GCNNGC 1 cut(s) 224
BstDEI CTNAG 3 cut(s) 98, 187, 287
BstF5I GGATG 1 cut(s) 288
BstMWI GCNNNNNNNGC 1 cut(s) 56
BsuI GTATCC 1 cut(s) 91
BtsCI GGATG 1 cut(s) 288
Cac8I GCNNGC 1 cut(s) 224
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 60
CviJI RGCY 5 cut(s) 30, 64, 97, 146, 226
CviKI_1 RGCY 5 cut(s) 30, 64, 97, 146, 226
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 3 cut(s) 98, 187, 287
Eco57I CTGAAG 1 cut(s) 89
FaeI CATG 1 cut(s) 63
FaiI YATR 8 cut(s) 39, 61, 132, 149, 175, 247, 258, 269
FalI AAGNNNNNCTT 2 cut(s) 48, 80
FatI CATG 1 cut(s) 59
Hin1II CATG 1 cut(s) 63
HincII GTYRAC 1 cut(s) 120
HindII GTYRAC 1 cut(s) 120
HpaI GTTAAC 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 2 cut(s) 115, 290
Hpy188III TCNNGA 1 cut(s) 251
Hpy8I GTNNAC 1 cut(s) 120
HpyCH4V TGCA 2 cut(s) 210, 222
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 3 cut(s) 98, 187, 287
Hsp92II CATG 1 cut(s) 63
KspAI GTTAAC 1 cut(s) 120
LpnPI CCDG 2 cut(s) 226, 236
LweI GCATC 1 cut(s) 273
MaeIII GTNAC 1 cut(s) 169
MnlI CCTC 1 cut(s) 153
MseI TTAA 2 cut(s) 119, 275
Mva1269I GAATGC 1 cut(s) 109
MwoI GCNNNNNNNGC 1 cut(s) 56
NlaIII CATG 1 cut(s) 63
NmuCI GTSAC 1 cut(s) 169
PctI GAATGC 1 cut(s) 109
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 119, 275
SetI ASST 3 cut(s) 148, 164, 228
SfaNI GCATC 1 cut(s) 273
TatI WGTACW 1 cut(s) 42
Tru1I TTAA 2 cut(s) 119, 275
Tru9I TTAA 2 cut(s) 119, 275
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.