RchiOBHm_Chr7g0232521

U-box domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0002207
Physical Location & Seq
Reverse (-)
56648449 .. 56649403
955 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20841

Sequence Viewer

Length: 195 bp
ATGTTGTGGTTAATGCGGGAAATCATGGACGACCCACACATTTCTGCCGATGGCTTTACTTATGAGTACAGAGCAATCAAAGCATGGCTTGACAAACACAACGTATCCCCAGTGACAAGGCTAAGACTTCAGCATTCAGAGTTAACTCCTAACCATACATTGCGTTCAGCCATACAAGAATGGGGTCACGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr U-box Usp

Protein Analysis

64

Amino Acids

7.58

Weight (kDa)

6.49

Isoelectric Point (pI)

49.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
U-box PF04564 4 - 61 1.9e-16 U-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 191
AciI CCGC 1 cut(s) 16
AcuI CTGAAG 1 cut(s) 113
AfaI GTAC 1 cut(s) 68
AflIII ACRYGT 1 cut(s) 189
BccI CCATC 1 cut(s) 44
BciVI GTATCC 1 cut(s) 115
BfuI GTATCC 1 cut(s) 115
BmrI ACTGGG 1 cut(s) 104
BmuI ACTGGG 1 cut(s) 104
Bse1I ACTGG 1 cut(s) 110
Bse3DI GCAATG 1 cut(s) 158
BseMI GCAATG 1 cut(s) 158
BseNI ACTGG 1 cut(s) 110
Bsh1236I CGCG 1 cut(s) 191
BsmI GAATGC 1 cut(s) 133
BspACI CCGC 1 cut(s) 16
BspFNI CGCG 1 cut(s) 191
BsrDI GCAATG 1 cut(s) 158
BsrI ACTGG 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 122
BstFNI CGCG 1 cut(s) 191
BstMWI GCNNNNNNNGC 1 cut(s) 80
BstUI CGCG 1 cut(s) 191
BsuI GTATCC 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 117
Csp6I GTAC 1 cut(s) 67
CviAII CATG 2 cut(s) 25, 84
CviJI RGCY 4 cut(s) 54, 88, 121, 170
CviKI_1 RGCY 4 cut(s) 54, 88, 121, 170
CviQI GTAC 1 cut(s) 67
DdeI CTNAG 1 cut(s) 122
Eco57I CTGAAG 1 cut(s) 113
FaeI CATG 2 cut(s) 28, 87
FaiI YATR 5 cut(s) 26, 63, 85, 156, 173
FalI AAGNNNNNCTT 2 cut(s) 72, 104
FatI CATG 2 cut(s) 24, 83
FauI CCCGC 1 cut(s) 9
Hin1II CATG 2 cut(s) 28, 87
HincII GTYRAC 1 cut(s) 144
HindII GTYRAC 1 cut(s) 144
HpaI GTTAAC 1 cut(s) 144
Hpy166II GTNNAC 1 cut(s) 144
Hpy188I TCNGA 1 cut(s) 139
Hpy8I GTNNAC 1 cut(s) 144
HpyCH4IV ACGT 1 cut(s) 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 122
HpySE526I ACGT 1 cut(s) 102
Hsp92II CATG 2 cut(s) 28, 87
KspAI GTTAAC 1 cut(s) 144
LpnPI CCDG 1 cut(s) 123
MaeII ACGT 1 cut(s) 102
MaeIII GTNAC 2 cut(s) 112, 185
MluI ACGCGT 1 cut(s) 189
MseI TTAA 2 cut(s) 11, 143
Mva1269I GAATGC 1 cut(s) 133
MvnI CGCG 1 cut(s) 191
MwoI GCNNNNNNNGC 1 cut(s) 80
NlaIII CATG 2 cut(s) 28, 87
NmuCI GTSAC 2 cut(s) 112, 185
PctI GAATGC 1 cut(s) 133
RsaI GTAC 1 cut(s) 68
RsaNI GTAC 1 cut(s) 67
SaqAI TTAA 2 cut(s) 11, 143
SetI ASST 1 cut(s) 105
SgeI CNNG 7 cut(s) 29, 37, 96, 101, 122, 129, 188
SsiI CCGC 1 cut(s) 16
TaiI ACGT 1 cut(s) 105
TatI WGTACW 1 cut(s) 66
Tru1I TTAA 2 cut(s) 11, 143
Tru9I TTAA 2 cut(s) 11, 143
TscAI CASTG 1 cut(s) 117
TseFI GTSAC 2 cut(s) 112, 185
Tsp45I GTSAC 2 cut(s) 112, 185
TspRI CASTG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.