Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3C

Orthogroup ID

OG0002207

Physical Location & Seq

Genomic Coordinates Forward (+)

47704002 .. 47706418

Gene Structure 2417 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3CG371600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

ATGCTACTTGGGGTGGAGAAGAAGAGGAAGGAGCTGGAAGATTTTGAATCTACTTTCAATTTGAGATCTCAAGCTTCTGAATTTGAACGGACTGTCCACATCCGCCTGATCTTGATAGAGCATATGAGTGCAACTCAGCCTCCAAAAACACGCTCTCACAGCTCTGTATGGCCAATTGCTGTGGCTAAAGAGGCTCATCTTACCCCACAAGCAAAACGTTTGATACACGAAAAGACTGCTCCAAGGAGCATCTTACATCAGTTCTTAATCTTAAAGATGAGGTATCCATTGCTACTGCTGAGCTGTGGACAGGGCCTGAACCATAATCTGGATCAATTTTACCTTCTCAATAAGTTTGATTTGAACTTATTGATTCTGGTGAGAAATTCAATTGAATCTCAACCTGTATTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Remorin_C

Protein Analysis

137

Amino Acids

15.89

Weight (kDa)

9.61

Isoelectric Point (pI)

71.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002207)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G19410 AT2G19410 AT2G19410 AT5G57035
fragaria_vesca	FvH4_1g07970 FvH4_1g07970 FvH4_1g07970 FvH4_1g07970 FvH4_1g07970
malus_domestica	MD02G1084100.v1.1
prunus_persica	Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1 Prupe.7G205400_v2.0.a1
pyrus_communis	pycom02g06680 pycom02g06690
rosa_chinensis	RchiOBHm_Chr1g0330911 RchiOBHm_Chr2g0093881 RchiOBHm_Chr2g0094001 RchiOBHm_Chr7g0232521
rosa_laevigata	RLG00000001329 RLG00000016442 RLG00000016444
rosa_multiflora	Rmu_sc0003027.1_g000005 Rmu_sc0017523.1_g000016 Rmu_ssc0000369.1_g000008
rosa_roxburghii	Rroxscaffold_2G00147570 Rroxscaffold_2G00147700
rosa_rugosa	Rorug02G0040200 Rorug02G0040300
rosa_samantha	Rh2AG086900 Rh2AG087700 Rh2BG087700 Rh2CG090000 Rh2DG085600 Rh2DG086700 Rh2DG086800 Rh3CG371600 Rh7CG448000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	412
AccB7I	CCANNNNNTGG	1 cut(s)	328
AciI	CCGC	1 cut(s)	103
AclI	AACGTT	1 cut(s)	217
AclWI	GGATC	1 cut(s)	339
AcoI	YGGCCR	1 cut(s)	170
AcsI	RAATTY	2 cut(s)	80, 385
AfiI	CCNNNNNNNGG	1 cut(s)	328
AgsI	TTSAA	6 cut(s)	47, 58, 86, 364, 390, 395
AloI	GAACNNNNNNTCC	2 cut(s)	78, 110
AluBI	AGCT	4 cut(s)	34, 74, 162, 303
AluI	AGCT	4 cut(s)	34, 74, 162, 303
AlwI	GGATC	1 cut(s)	339
AlwNI	CAGNNNCTG	1 cut(s)	316
AoxI	GGCC	2 cut(s)	170, 313
ApoI	RAATTY	2 cut(s)	80, 385
AspS9I	GGNCC	1 cut(s)	313
AsuHPI	GGTGA	1 cut(s)	391
BalI	TGGCCA	1 cut(s)	172
BcgI	CGANNNNNNTGC	2 cut(s)	218, 252
BciVI	GTATCC	1 cut(s)	294
BfuI	GTATCC	1 cut(s)	294
BglII	AGATCT	1 cut(s)	65
BlpI	GCTNAGC	1 cut(s)	299
BmgT120I	GGNCC	1 cut(s)	313
BmsI	GCATC	1 cut(s)	258
BplI	GAGNNNNNCTC	2 cut(s)	118, 150
Bpu1102I	GCTNAGC	1 cut(s)	299
BpuEI	CTTGAG	1 cut(s)	54
BsaJI	CCNNGG	1 cut(s)	242
BsaXI	ACNNNNNCTCC	2 cut(s)	124, 154
Bsc4I	CCNNNNNNNGG	1 cut(s)	328
Bse3DI	GCAATG	1 cut(s)	287
BseDI	CCNNGG	1 cut(s)	242
BseGI	GGATG	1 cut(s)	99
BseLI	CCNNNNNNNGG	1 cut(s)	328
BseMI	GCAATG	1 cut(s)	287
BseMII	CTCAG	2 cut(s)	149, 290
BshFI	GGCC	2 cut(s)	172, 315
BslI	CCNNNNNNNGG	1 cut(s)	328
BsnI	GGCC	2 cut(s)	172, 315
Bsp143I	GATC	3 cut(s)	65, 108, 331
Bsp1720I	GCTNAGC	1 cut(s)	299
BspACI	CCGC	1 cut(s)	103
BspANI	GGCC	2 cut(s)	172, 315
BspCNI	CTCAG	2 cut(s)	148, 291
BspPI	GGATC	1 cut(s)	339
BsrDI	GCAATG	1 cut(s)	287
BssECI	CCNNGG	1 cut(s)	242
BssMI	GATC	3 cut(s)	65, 108, 331
BssT1I	CCWWGG	1 cut(s)	242
Bst4CI	ACNGT	1 cut(s)	94
Bst6I	CTCTTC	1 cut(s)	17
BstDEI	CTNAG	2 cut(s)	135, 299
BstF5I	GGATG	1 cut(s)	99
BstKTI	GATC	3 cut(s)	68, 111, 334
BstMBI	GATC	3 cut(s)	65, 108, 331
BstMWI	GCNNNNNNNGC	2 cut(s)	159, 191
BstX2I	RGATCY	1 cut(s)	65
BstYI	RGATCY	1 cut(s)	65
BsuI	GTATCC	1 cut(s)	294
BsuRI	GGCC	2 cut(s)	172, 315
BtsCI	GGATG	1 cut(s)	99
CaiI	CAGNNNCTG	1 cut(s)	316
Cfr13I	GGNCC	1 cut(s)	313
CspCI	CAANNNNNGTGG	2 cut(s)	162, 197
CviJI	RGCY	9 cut(s)	34, 74, 139, 162, 172, 185, 194, 303, 315
CviKI_1	RGCY	9 cut(s)	34, 74, 139, 162, 172, 185, 194, 303, 315
DdeI	CTNAG	2 cut(s)	135, 299
DpnI	GATC	3 cut(s)	67, 110, 333
DpnII	GATC	3 cut(s)	65, 108, 331
EaeI	YGGCCR	1 cut(s)	170
Eam1104I	CTCTTC	1 cut(s)	17
EarI	CTCTTC	1 cut(s)	17
EciI	GGCGGA	1 cut(s)	92
Eco130I	CCWWGG	1 cut(s)	242
EcoO109I	RGGNCCY	1 cut(s)	313
EcoT14I	CCWWGG	1 cut(s)	242
ErhI	CCWWGG	1 cut(s)	242
FaiI	YATR	5 cut(s)	123, 125, 169, 324, 412
FauNDI	CATATG	1 cut(s)	123
FokI	GGATG	1 cut(s)	86
HaeIII	GGCC	2 cut(s)	172, 315
HindIII	AAGCTT	1 cut(s)	72
HinfI	GANTC	3 cut(s)	47, 373, 395
HphI	GGTGA	1 cut(s)	391
Hpy166II	GTNNAC	2 cut(s)	97, 308
Hpy188I	TCNGA	1 cut(s)	79
Hpy188III	TCNNGA	2 cut(s)	112, 329
Hpy8I	GTNNAC	2 cut(s)	97, 308
HpyAV	CCTTC	2 cut(s)	22, 353
HpyCH4III	ACNGT	1 cut(s)	94
HpyCH4IV	ACGT	1 cut(s)	217
HpyCH4V	TGCA	1 cut(s)	131
HpyF10VI	GCNNNNNNNGC	2 cut(s)	159, 191
HpyF3I	CTNAG	2 cut(s)	135, 299
HpySE526I	ACGT	1 cut(s)	217
Kzo9I	GATC	3 cut(s)	65, 108, 331
LmnI	GCTCC	3 cut(s)	31, 244, 246
LpnPI	CCDG	6 cut(s)	20, 119, 296, 314, 329, 362
LweI	GCATC	1 cut(s)	258
MaeII	ACGT	1 cut(s)	217
MalI	GATC	3 cut(s)	67, 110, 333
MboI	GATC	3 cut(s)	65, 108, 331
MboII	GAAGA	3 cut(s)	31, 34, 50
MfeI	CAATTG	2 cut(s)	174, 390
MflI	RGATCY	1 cut(s)	65
MlsI	TGGCCA	1 cut(s)	172
MluCI	AATT	6 cut(s)	58, 80, 174, 335, 385, 390
MluNI	TGGCCA	1 cut(s)	172
MnlI	CCTC	4 cut(s)	18, 150, 184, 273
Mox20I	TGGCCA	1 cut(s)	172
MscI	TGGCCA	1 cut(s)	172
MseI	TTAA	2 cut(s)	266, 272
MslI	CAYNNNNRTG	1 cut(s)	126
Msp20I	TGGCCA	1 cut(s)	172
MunI	CAATTG	2 cut(s)	174, 390
MwoI	GCNNNNNNNGC	2 cut(s)	159, 191
NdeI	CATATG	1 cut(s)	123
NdeII	GATC	3 cut(s)	65, 108, 331
PfeI	GAWTC	3 cut(s)	47, 373, 395
PflMI	CCANNNNNTGG	1 cut(s)	328
PsiI	TTATAA	1 cut(s)	412
Psp1406I	AACGTT	1 cut(s)	217
PspPI	GGNCC	1 cut(s)	313
PstNI	CAGNNNCTG	1 cut(s)	316
PsuI	RGATCY	1 cut(s)	65
RseI	CAYNNNNRTG	1 cut(s)	126
SaqAI	TTAA	2 cut(s)	266, 272
Sau3AI	GATC	3 cut(s)	65, 108, 331
Sau96I	GGNCC	1 cut(s)	313
SetI	ASST	8 cut(s)	36, 76, 164, 220, 284, 305, 345, 406
SfaNI	GCATC	1 cut(s)	258
SmiMI	CAYNNNNRTG	1 cut(s)	126
SmlI	CTYRAG	1 cut(s)	69
SmoI	CTYRAG	1 cut(s)	69
Sse9I	AATT	6 cut(s)	58, 80, 174, 335, 385, 390
SsiI	CCGC	1 cut(s)	103
StyI	CCWWGG	1 cut(s)	242
TaaI	ACNGT	1 cut(s)	94
TaiI	ACGT	1 cut(s)	220
TasI	AATT	6 cut(s)	58, 80, 174, 335, 385, 390
TfiI	GAWTC	3 cut(s)	47, 373, 395
Tru1I	TTAA	2 cut(s)	266, 272
Tru9I	TTAA	2 cut(s)	266, 272
TspGWI	ACGGA	1 cut(s)	103
Van91I	CCANNNNNTGG	1 cut(s)	328
XapI	RAATTY	2 cut(s)	80, 385

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.