RchiOBHm_Chr2g0131581

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
47896506 .. 47897277
772 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50292

Sequence Viewer

Length: 225 bp
ATGAGTTGGTGCAACAAATCAAGCTGTAGGCTGCGAGCTTTCCTTTCTTCCCTACAAATAGTAGCTGTTATACGTACTCTACAAACACTGCCGGACTTCCGGGGCGTTACACTTGACATGAGGTCACTTGTGCTTCTACCTCCTTTAGGGACATTGCCATTCCTTGAAGCGTTGGAAATAAAGGTCAATGATAATGACATTGCCATACCAACTGGCCCTGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.18

Weight (kDa)

6.1

Isoelectric Point (pI)

49.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 1 cut(s) 167
AhdI GACNNNNNGTC 1 cut(s) 121
AluBI AGCT 3 cut(s) 24, 38, 65
AluI AGCT 3 cut(s) 24, 38, 65
AoxI GGCC 1 cut(s) 214
ApeKI GCWGC 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 215
AsuC2I CCSGG 1 cut(s) 101
BbvI GCAGC 1 cut(s) 18
BcnI CCSGG 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 25
BisI GCNGC 1 cut(s) 32
BlsI GCNGC 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 101
BmeRI GACNNNNNGTC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 101
BpuMI CCSGG 1 cut(s) 101
BsaAI YACGTR 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 100
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 217
Bse3DI GCAATG 2 cut(s) 152, 198
BseDI CCNNGG 1 cut(s) 100
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMI GCAATG 2 cut(s) 152, 198
BseNI ACTGG 1 cut(s) 217
BseXI GCAGC 1 cut(s) 18
BshFI GGCC 1 cut(s) 216
BsiSI CCGG 2 cut(s) 92, 100
BslFI GGGAC 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 146
BsmFI GGGAC 1 cut(s) 163
BsnI GGCC 1 cut(s) 216
BspANI GGCC 1 cut(s) 216
BsrDI GCAATG 2 cut(s) 152, 198
BsrI ACTGG 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 100
BstBAI YACGTR 1 cut(s) 74
BstC8I GCNNGC 1 cut(s) 36
BstENI CCTNNNNNAGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 99
BstSFI CTRYAG 1 cut(s) 25
BstSNI TACGTA 1 cut(s) 74
BstV1I GCAGC 1 cut(s) 18
BsuRI GGCC 1 cut(s) 216
BtsI GCAGTG 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 86
Cac8I GCNNGC 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 215
Csp6I GTAC 1 cut(s) 75
CviAII CATG 1 cut(s) 118
CviJI RGCY 5 cut(s) 24, 31, 38, 65, 216
CviKI_1 RGCY 5 cut(s) 24, 31, 38, 65, 216
CviQI GTAC 1 cut(s) 75
DriI GACNNNNNGTC 1 cut(s) 121
Eam1105I GACNNNNNGTC 1 cut(s) 121
Eco105I TACGTA 1 cut(s) 74
EcoNI CCTNNNNNAGG 1 cut(s) 144
FaeI CATG 1 cut(s) 121
FaiI YATR 3 cut(s) 71, 119, 206
FaqI GGGAC 1 cut(s) 163
FatI CATG 1 cut(s) 117
Fnu4HI GCNGC 1 cut(s) 32
Fsp4HI GCNGC 1 cut(s) 32
GluI GCNGC 1 cut(s) 32
HaeIII GGCC 1 cut(s) 216
HapII CCGG 2 cut(s) 92, 100
Hin1II CATG 1 cut(s) 121
HpaII CCGG 2 cut(s) 92, 100
HpyCH4IV ACGT 1 cut(s) 73
HpyCH4V TGCA 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 73
Hsp92II CATG 1 cut(s) 121
LpnPI CCDG 3 cut(s) 105, 113, 198
Lsp1109I GCAGC 1 cut(s) 18
MaeII ACGT 1 cut(s) 73
MaeIII GTNAC 2 cut(s) 106, 123
MboII GAAGA 1 cut(s) 39
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 2 cut(s) 114, 150
MspI CCGG 2 cut(s) 92, 100
MspR9I CCNGG 1 cut(s) 101
NciI CCSGG 1 cut(s) 101
NlaIII CATG 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 123
PkrI GCNGC 1 cut(s) 33
Ppu21I YACGTR 1 cut(s) 74
PspPI GGNCC 1 cut(s) 215
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
SatI GCNGC 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 101
SetI ASST 7 cut(s) 26, 40, 67, 76, 125, 142, 186
SfcI CTRYAG 1 cut(s) 25
SgeI CNNG 9 cut(s) 33, 47, 104, 112, 113, 125, 130, 140, 176
SnaBI TACGTA 1 cut(s) 74
StyD4I CCNGG 1 cut(s) 99
TaiI ACGT 1 cut(s) 76
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 123
TseI GCWGC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 123
TspRI CASTG 1 cut(s) 93
XagI CCTNNNNNAGG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.