Rh2BG359700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0008174
Physical Location & Seq
Reverse (-)
49812387 .. 49813295
909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG359700.1

Sequence Viewer

Length: 333 bp
ATGATCCACTCTTATATTCAGGGATTGGGAGGGTCGAACCTCCAGGTTGTAATGGCTGGATTCCCTAAGACCGAATGCCCCCATCCTCAGTTGGGCCTCTTTTTCCAAATCTCTTGTGACCATGTGCTCTCGTGCAAGGAAATTCAACACCAGATTTTTTCTTTGGTTGTACCTAGGAATGTTATAATCTACTTAAGGCGATCAGTGGGTAGTGAAATTAATAGTAACATCATTCATCATGTGGATATTGCTTCTGGCTTGTACGCTAGACTGTTCTGTCGACATCCCATCCTGCTAAAAATGTCAGCACTTGCTAGTAAATCAGTTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.26

Weight (kDa)

8.82

Isoelectric Point (pI)

65.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 185
AasI GACNNNNNNGTC 1 cut(s) 276
AccI GTMKAC 1 cut(s) 280
AcsI RAATTY 1 cut(s) 141
AfaI GTAC 2 cut(s) 171, 263
AfiI CCNNNNNNNGG 1 cut(s) 92
AflII CTTAAG 1 cut(s) 193
AgsI TTSAA 1 cut(s) 146
AjnI CCWGG 1 cut(s) 42
Alw21I GWGCWC 1 cut(s) 129
AoxI GGCC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 141
AseI ATTAAT 1 cut(s) 219
AspA2I CCTAGG 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 94
AvrII CCTAGG 1 cut(s) 173
BauI CACGAG 1 cut(s) 130
Bbv12I GWGCWC 1 cut(s) 129
BccI CCATC 2 cut(s) 90, 296
BciT130I CCWGG 1 cut(s) 44
BfaI CTAG 3 cut(s) 174, 267, 315
BfrI CTTAAG 1 cut(s) 193
BlnI CCTAGG 1 cut(s) 173
Bme1390I CCNGG 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 94
BmrFI CCNGG 1 cut(s) 44
BpmI CTGGAG 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 173
Bsc4I CCNNNNNNNGG 1 cut(s) 92
BseBI CCWGG 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 173
BseGI GGATG 3 cut(s) 82, 283, 288
BseLI CCNNNNNNNGG 1 cut(s) 92
BseMII CTCAG 1 cut(s) 101
BshFI GGCC 1 cut(s) 96
BsiHKAI GWGCWC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 92
BsmI GAATGC 1 cut(s) 80
BsnI GGCC 1 cut(s) 96
Bsp1286I GDGCHC 1 cut(s) 129
Bsp143I GATC 2 cut(s) 3, 200
BspANI GGCC 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 100
BspTI CTTAAG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 173
BssMI GATC 2 cut(s) 3, 200
BssSI CACGAG 1 cut(s) 130
BssT1I CCWWGG 1 cut(s) 173
Bst2BI CACGAG 1 cut(s) 130
Bst2UI CCWGG 1 cut(s) 44
Bst4CI ACNGT 1 cut(s) 273
BstAFI CTTAAG 1 cut(s) 193
BstDEI CTNAG 2 cut(s) 66, 87
BstF5I GGATG 3 cut(s) 82, 283, 288
BstKTI GATC 2 cut(s) 6, 203
BstMBI GATC 2 cut(s) 3, 200
BstNI CCWGG 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 42
BsuRI GGCC 1 cut(s) 96
BtsCI GGATG 3 cut(s) 82, 283, 288
BtsIMutI CAGTG 1 cut(s) 210
Cfr13I GGNCC 1 cut(s) 94
Csp6I GTAC 2 cut(s) 170, 262
CviAII CATG 2 cut(s) 122, 239
CviJI RGCY 3 cut(s) 56, 96, 258
CviKI_1 RGCY 3 cut(s) 56, 96, 258
CviQI GTAC 2 cut(s) 170, 262
DdeI CTNAG 2 cut(s) 66, 87
DpnI GATC 2 cut(s) 5, 202
DpnII GATC 2 cut(s) 3, 200
DrdI GACNNNNNNGTC 1 cut(s) 276
DseDI GACNNNNNNGTC 1 cut(s) 276
Eco130I CCWWGG 1 cut(s) 173
EcoRII CCWGG 1 cut(s) 42
EcoT14I CCWWGG 1 cut(s) 173
ErhI CCWWGG 1 cut(s) 173
FaeI CATG 2 cut(s) 125, 242
FaiI YATR 4 cut(s) 15, 123, 185, 240
FatI CATG 2 cut(s) 121, 238
FblI GTMKAC 1 cut(s) 280
FokI GGATG 3 cut(s) 69, 270, 275
FspBI CTAG 3 cut(s) 174, 267, 315
GsuI CTGGAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 96
Hin1II CATG 2 cut(s) 125, 242
HincII GTYRAC 2 cut(s) 281, 328
HindII GTYRAC 2 cut(s) 281, 328
HinfI GANTC 1 cut(s) 60
Hpy166II GTNNAC 2 cut(s) 281, 328
Hpy8I GTNNAC 2 cut(s) 281, 328
HpyCH4III ACNGT 1 cut(s) 273
HpyCH4V TGCA 1 cut(s) 135
HpyF3I CTNAG 2 cut(s) 66, 87
Hsp92II CATG 2 cut(s) 125, 242
Kzo9I GATC 2 cut(s) 3, 200
LpnPI CCDG 7 cut(s) 5, 29, 42, 56, 164, 240, 305
MaeI CTAG 3 cut(s) 174, 267, 315
MaeIII GTNAC 2 cut(s) 116, 224
MalI GATC 2 cut(s) 5, 202
MboI GATC 2 cut(s) 3, 200
MhlI GDGCHC 1 cut(s) 129
MluCI AATT 2 cut(s) 141, 216
MnlI CCTC 4 cut(s) 23, 50, 96, 107
MseI TTAA 2 cut(s) 194, 219
MspCI CTTAAG 1 cut(s) 193
MspR9I CCNGG 1 cut(s) 44
Mva1269I GAATGC 1 cut(s) 80
MvaI CCWGG 1 cut(s) 44
NdeII GATC 2 cut(s) 3, 200
NlaIII CATG 2 cut(s) 125, 242
NmuCI GTSAC 1 cut(s) 116
PctI GAATGC 1 cut(s) 80
PfeI GAWTC 1 cut(s) 60
PshBI ATTAAT 1 cut(s) 219
PsiI TTATAA 1 cut(s) 185
Psp6I CCWGG 1 cut(s) 42
PspGI CCWGG 1 cut(s) 42
PspPI GGNCC 1 cut(s) 94
RsaI GTAC 2 cut(s) 171, 263
RsaNI GTAC 2 cut(s) 170, 262
SalI GTCGAC 1 cut(s) 279
SaqAI TTAA 2 cut(s) 194, 219
Sau3AI GATC 2 cut(s) 3, 200
Sau96I GGNCC 1 cut(s) 94
ScrFI CCNGG 1 cut(s) 44
SduI GDGCHC 1 cut(s) 129
SetI ASST 3 cut(s) 42, 48, 175
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
Sse9I AATT 2 cut(s) 141, 216
SspMI CTAG 3 cut(s) 174, 267, 315
StyD4I CCNGG 1 cut(s) 42
StyI CCWWGG 1 cut(s) 173
TaaI ACNGT 1 cut(s) 273
TaqI TCGA 2 cut(s) 35, 280
TaqII GACCGA 1 cut(s) 86
TasI AATT 2 cut(s) 141, 216
TfiI GAWTC 1 cut(s) 60
Tru1I TTAA 2 cut(s) 194, 219
Tru9I TTAA 2 cut(s) 194, 219
TscAI CASTG 1 cut(s) 210
TseFI GTSAC 1 cut(s) 116
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 224
TspRI CASTG 1 cut(s) 210
Vha464I CTTAAG 1 cut(s) 193
VspI ATTAAT 1 cut(s) 219
XapI RAATTY 1 cut(s) 141
XmaJI CCTAGG 1 cut(s) 173
XmiI GTMKAC 1 cut(s) 280
XspI CTAG 3 cut(s) 174, 267, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.