Rroxscaffold_2G00112510

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
37692035 .. 37697876
5842 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00112510.1

Sequence Viewer

Length: 201 bp
ATGTGGCGATTTGAGCCAGTTATTCAGTTTTCTTCTCTTCTCTTCTCTTCTCTTCTAGGATCAACTTCCCCACAAGGTCAACTGCTGATTGATGACCACCTCAGCCACTTCTTCACTTCTCTTCCAGGATTGGGAGGGTCGAGCCTCCAAGTTGTAATGGCTGGATTCCCTAAGACCGAATGCCCCCATCCTCAGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.2

Weight (kDa)

5.74

Isoelectric Point (pI)

58.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 67
AfiI CCNNNNNNNGG 2 cut(s) 131, 193
AjnI CCWGG 1 cut(s) 124
AlwI GGATC 1 cut(s) 67
AxyI CCTNAGG 1 cut(s) 192
BbvCI CCTCAGC 1 cut(s) 101
BccI CCATC 1 cut(s) 195
BciT130I CCWGG 1 cut(s) 126
BfaI CTAG 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 126
Bpu10I CCTNAGC 1 cut(s) 101
Bsc4I CCNNNNNNNGG 2 cut(s) 131, 193
Bse1I ACTGG 1 cut(s) 17
Bse21I CCTNAGG 1 cut(s) 192
BseBI CCWGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 187
BseLI CCNNNNNNNGG 2 cut(s) 131, 193
BseMII CTCAG 1 cut(s) 115
BseNI ACTGG 1 cut(s) 17
BslI CCNNNNNNNGG 2 cut(s) 131, 193
BsmI GAATGC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 114
BspPI GGATC 1 cut(s) 67
BsrI ACTGG 1 cut(s) 17
BssMI GATC 1 cut(s) 59
Bst2UI CCWGG 1 cut(s) 126
Bst6I CTCTTC 5 cut(s) 42, 47, 52, 57, 126
BstDEI CTNAG 3 cut(s) 101, 171, 192
BstF5I GGATG 1 cut(s) 187
BstKTI GATC 1 cut(s) 62
BstMBI GATC 1 cut(s) 59
BstMWI GCNNNNNNNGC 1 cut(s) 13
BstNI CCWGG 1 cut(s) 126
BstSCI CCNGG 1 cut(s) 124
Bsu36I CCTNAGG 1 cut(s) 192
BtsCI GGATG 1 cut(s) 187
CviJI RGCY 4 cut(s) 16, 105, 144, 161
CviKI_1 RGCY 4 cut(s) 16, 105, 144, 161
DdeI CTNAG 3 cut(s) 101, 171, 192
DpnI GATC 1 cut(s) 61
DpnII GATC 1 cut(s) 59
Eam1104I CTCTTC 5 cut(s) 42, 47, 52, 57, 126
EarI CTCTTC 5 cut(s) 42, 47, 52, 57, 126
Eco81I CCTNAGG 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 124
FaiI YATR 1 cut(s) 199
FokI GGATG 1 cut(s) 174
FspBI CTAG 1 cut(s) 56
HincII GTYRAC 1 cut(s) 80
HindII GTYRAC 1 cut(s) 80
HinfI GANTC 1 cut(s) 165
Hpy166II GTNNAC 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 13
HpyF3I CTNAG 3 cut(s) 101, 171, 192
Kzo9I GATC 1 cut(s) 59
LpnPI CCDG 5 cut(s) 30, 111, 138, 147, 179
MaeI CTAG 1 cut(s) 56
MalI GATC 1 cut(s) 61
MboI GATC 1 cut(s) 59
MboII GAAGA 7 cut(s) 24, 29, 34, 39, 44, 103, 113
MnlI CCTC 4 cut(s) 110, 128, 155, 201
MspR9I CCNGG 1 cut(s) 126
Mva1269I GAATGC 1 cut(s) 185
MvaI CCWGG 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 13
NdeII GATC 1 cut(s) 59
PctI GAATGC 1 cut(s) 185
PfeI GAWTC 1 cut(s) 165
PfoI TCCNGGA 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
Sau3AI GATC 1 cut(s) 59
ScrFI CCNGG 1 cut(s) 126
SetI ASST 3 cut(s) 79, 102, 198
SgeI CNNG 8 cut(s) 29, 68, 86, 137, 138, 153, 161, 174
SspMI CTAG 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 124
TaqI TCGA 1 cut(s) 140
TaqII GACCGA 1 cut(s) 191
TfiI GAWTC 1 cut(s) 165
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.