Rroxscaffold_2G00112570

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
37765413 .. 37770301
4889 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00112570.1

Sequence Viewer

Length: 168 bp
ATGGCAACATTGAACAGGAAGCTATGGAAGATGGACAGAAAAATTGCAGTGCCAGCACTTGCTGTTGAACCAATTGAGTGCAAATGCAGTGGTCCTCACGGACACTTGAAAAGTGTTCTTTCGATGGTCTTCACAGCACCTACAACAATTTTTGGTTTTCCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.09

Weight (kDa)

9.59

Isoelectric Point (pI)

51.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 13, 68, 109
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 92
AvaII GGWCC 1 cut(s) 92
BbsI GAAGAC 1 cut(s) 121
BccI CCATC 2 cut(s) 25, 118
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 92
BpiI GAAGAC 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 54
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstV2I GAAGAC 1 cut(s) 121
BtsI GCAGTG 2 cut(s) 54, 94
BtsIMutI CAGTG 2 cut(s) 54, 94
Cac8I GCNNGC 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 92
CspCI CAANNNNNGTGG 2 cut(s) 70, 105
CviJI RGCY 1 cut(s) 22
CviKI_1 RGCY 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 92
FaiI YATR 1 cut(s) 25
HpyCH4V TGCA 3 cut(s) 47, 81, 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 66
MboII GAAGA 2 cut(s) 40, 121
MfeI CAATTG 1 cut(s) 72
MluCI AATT 3 cut(s) 42, 72, 147
MnlI CCTC 1 cut(s) 105
MunI CAATTG 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 92
Sau96I GGNCC 1 cut(s) 92
SetI ASST 2 cut(s) 24, 142
SgeI CNNG 5 cut(s) 28, 65, 71, 110, 118
SinI GGWCC 1 cut(s) 92
Sse9I AATT 3 cut(s) 42, 72, 147
TaqI TCGA 1 cut(s) 122
TasI AATT 3 cut(s) 42, 72, 147
TscAI CASTG 2 cut(s) 54, 94
TspGWI ACGGA 1 cut(s) 114
TspRI CASTG 2 cut(s) 54, 94
VpaK11BI GGWCC 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.