RchiOBHm_Chr2g0131861

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
48224755 .. 48230065
5311 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50316

Sequence Viewer

Length: 144 bp
ATGCTTCCTCTGATGCTGGAACCCAGCTCCCTATCTAGTGGAGATGTCTTCACTCTGTTGGCTTTATTTCTTCAAAATTTGGAAAGGATTCCAAGCAAAGTCTTATGTGGAGGGACTAGGGAGGTCAGGTCCTTTAAGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.24

Weight (kDa)

7.96

Isoelectric Point (pI)

45.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 76
AgsI TTSAA 1 cut(s) 74
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
ApoI RAATTY 1 cut(s) 76
Asp700I GAANNNNTTC 1 cut(s) 87
AspS9I GGNCC 1 cut(s) 129
AvaII GGWCC 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 40
BfaI CTAG 2 cut(s) 36, 117
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
BmiI GGNNCC 1 cut(s) 21
BmsI GCATC 1 cut(s) 3
BpiI GAAGAC 1 cut(s) 40
BsaXI ACNNNNNCTCC 2 cut(s) 113, 143
BseYI CCCAGC 1 cut(s) 23
BslFI GGGAC 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 21
BstV2I GAAGAC 1 cut(s) 40
Cfr13I GGNCC 1 cut(s) 129
CviJI RGCY 2 cut(s) 27, 62
CviKI_1 RGCY 2 cut(s) 27, 62
Eco47I GGWCC 1 cut(s) 129
EcoO109I RGGNCCY 1 cut(s) 129
FaiI YATR 1 cut(s) 106
FaqI GGGAC 1 cut(s) 127
FspBI CTAG 2 cut(s) 36, 117
GsaI CCCAGC 1 cut(s) 27
HinfI GANTC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 12, 143
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 3 cut(s) 2, 37, 112
LweI GCATC 1 cut(s) 3
MaeI CTAG 2 cut(s) 36, 117
MboII GAAGA 2 cut(s) 40, 62
MluCI AATT 1 cut(s) 76
MnlI CCTC 3 cut(s) 18, 104, 115
MroXI GAANNNNTTC 1 cut(s) 87
MseI TTAA 1 cut(s) 135
NlaIV GGNNCC 1 cut(s) 21
PdmI GAANNNNTTC 1 cut(s) 87
PfeI GAWTC 1 cut(s) 88
PpuMI RGGWCCY 1 cut(s) 129
Psp5II RGGWCCY 1 cut(s) 129
PspFI CCCAGC 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 129
PspPPI RGGWCCY 1 cut(s) 129
SaqAI TTAA 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 129
SetI ASST 3 cut(s) 29, 126, 131
SfaNI GCATC 1 cut(s) 3
SgeI CNNG 6 cut(s) 29, 36, 48, 105, 129, 139
SinI GGWCC 1 cut(s) 129
Sse9I AATT 1 cut(s) 76
SspMI CTAG 2 cut(s) 36, 117
TasI AATT 1 cut(s) 76
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 129
XapI RAATTY 1 cut(s) 76
XmnI GAANNNNTTC 1 cut(s) 87
XspI CTAG 2 cut(s) 36, 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.