RchiOBHm_Chr2g0148071

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
65712806 .. 65715308
2503 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51765

Sequence Viewer

Length: 153 bp
ATGCAACATTTGAGATTAGCGATTCAACTTGAAAAACAAAGAAAAAAAATCTCTAACGATTGGTTTGGCTCTAGAGGAAGTGACACTGGAGTCACTATCCAGACCTACCAGGTGTCTAATGTTGATAAGAACCTACTCCAAGTTTCGCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.75

Weight (kDa)

9.82

Isoelectric Point (pI)

9.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 89
AgsI TTSAA 2 cut(s) 26, 32
AjnI CCWGG 1 cut(s) 108
BciT130I CCWGG 1 cut(s) 110
BfaI CTAG 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BpmI CTGGAG 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 91
BsrI ACTGG 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 110
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 84
CsiI ACCWGGT 1 cut(s) 108
CviJI RGCY 1 cut(s) 69
CviKI_1 RGCY 1 cut(s) 69
DrdI GACNNNNNNGTC 1 cut(s) 89
DseDI GACNNNNNNGTC 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 108
FspBI CTAG 1 cut(s) 72
FspEI CC 9 cut(s) 46, 51, 60, 72, 95, 113, 118, 122, 146
GsuI CTGGAG 1 cut(s) 108
HinfI GANTC 2 cut(s) 22, 90
Hpy188I TCNGA 1 cut(s) 152
Hpy188III TCNNGA 2 cut(s) 72, 100
HpyCH4V TGCA 1 cut(s) 4
LpnPI CCDG 4 cut(s) 72, 95, 113, 122
MabI ACCWGGT 1 cut(s) 108
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 2 cut(s) 80, 91
MlyI GAGTC 1 cut(s) 99
MnlI CCTC 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NmuCI GTSAC 2 cut(s) 80, 91
PfeI GAWTC 1 cut(s) 22
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
SchI GAGTC 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 110
SetI ASST 3 cut(s) 107, 114, 135
SexAI ACCWGGT 1 cut(s) 108
SgeI CNNG 6 cut(s) 41, 84, 99, 112, 121, 122
SspMI CTAG 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 108
TfiI GAWTC 1 cut(s) 22
TscAI CASTG 1 cut(s) 91
TseFI GTSAC 2 cut(s) 80, 91
Tsp45I GTSAC 2 cut(s) 80, 91
TspRI CASTG 1 cut(s) 91
XbaI TCTAGA 1 cut(s) 71
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.