Rh6AG345900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
54664715 .. 54669467
4753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG345900.1

Sequence Viewer

Length: 150 bp
ATGAGAGATTTGTTCAAGCACTGTATCGCCGATGGAAAGGAGCTCAGTGGAAGAATCGGAGCAAGCCACAATGGAAGTCGCGAATCCTATTCCAATTCCATTTCGATTTTGAGGATTCCTGAGTTTCTCTGTGATTTGGATCCTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.46

Weight (kDa)

6.01

Isoelectric Point (pI)

24.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 81
AclWI GGATC 2 cut(s) 134, 147
AgsI TTSAA 1 cut(s) 16
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
Alw21I GWGCWC 1 cut(s) 45
AlwI GGATC 2 cut(s) 134, 147
BamHI GGATCC 1 cut(s) 139
BanII GRGCYC 1 cut(s) 45
Bbv12I GWGCWC 1 cut(s) 45
BccI CCATC 1 cut(s) 26
BmiI GGNNCC 1 cut(s) 141
BsaBI GATNNNNATC 1 cut(s) 138
Bse8I GATNNNNATC 1 cut(s) 138
BseJI GATNNNNATC 1 cut(s) 138
BseMII CTCAG 2 cut(s) 58, 111
Bsh1236I CGCG 1 cut(s) 81
BsiHKAI GWGCWC 1 cut(s) 45
Bsp1286I GDGCHC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 139
Bsp68I TCGCGA 1 cut(s) 81
BspCNI CTCAG 2 cut(s) 57, 112
BspFNI CGCG 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 141
BspPI GGATC 2 cut(s) 134, 147
BssMI GATC 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 2 cut(s) 44, 120
BstFNI CGCG 1 cut(s) 81
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstUI CGCG 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 139
BstYI RGATCY 1 cut(s) 139
BtsIMutI CAGTG 2 cut(s) 19, 52
BtuMI TCGCGA 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 64
CviJI RGCY 2 cut(s) 43, 66
CviKI_1 RGCY 2 cut(s) 43, 66
DdeI CTNAG 2 cut(s) 44, 120
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
Ecl136II GAGCTC 1 cut(s) 43
Eco24I GRGCYC 1 cut(s) 45
Eco53kI GAGCTC 1 cut(s) 43
EcoICRI GAGCTC 1 cut(s) 43
EcoT38I GRGCYC 1 cut(s) 45
FriOI GRGCYC 1 cut(s) 45
HinfI GANTC 3 cut(s) 54, 83, 115
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 2 cut(s) 80, 119
HpyCH4III ACNGT 1 cut(s) 23
HpyF3I CTNAG 2 cut(s) 44, 120
Kzo9I GATC 1 cut(s) 139
LmnI GCTCC 2 cut(s) 40, 59
LpnPI CCDG 1 cut(s) 132
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 63
MflI RGATCY 1 cut(s) 139
MhlI GDGCHC 1 cut(s) 45
MluCI AATT 2 cut(s) 94, 145
MnlI CCTC 1 cut(s) 105
MvnI CGCG 1 cut(s) 81
NdeII GATC 1 cut(s) 139
NlaIV GGNNCC 1 cut(s) 141
NruI TCGCGA 1 cut(s) 81
PfeI GAWTC 3 cut(s) 54, 83, 115
Psp124BI GAGCTC 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 141
PsuI RGATCY 1 cut(s) 139
RruI TCGCGA 1 cut(s) 81
SacI GAGCTC 1 cut(s) 45
Sau3AI GATC 1 cut(s) 139
SduI GDGCHC 1 cut(s) 45
SetI ASST 1 cut(s) 45
SgeI CNNG 4 cut(s) 28, 75, 92, 131
Sse9I AATT 2 cut(s) 94, 145
SstI GAGCTC 1 cut(s) 45
TaaI ACNGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 104
TasI AATT 2 cut(s) 94, 145
TfiI GAWTC 3 cut(s) 54, 83, 115
TscAI CASTG 2 cut(s) 26, 52
TspRI CASTG 2 cut(s) 26, 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.