RchiOBHm_Chr4g0430511

Cell division control protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
55025229 .. 55026429
1201 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39923

Sequence Viewer

Length: 189 bp
ATGCAGGTGAGAATTGATCACATGGTTGTTGCTTTGTCAAAGACATTCAAGTCACCAGTAATGGATACCATACAATGTCTTCCTCAACATCAACAGTTAAATAAATATTCTTACATGGACATCTGCAAATCAATACTAATTCCACCACTTGGAAGTTTTCAATTTTCAAGTGTGCAAAGTGCTACATGA

Protein Analysis

62

Amino Acids

7.03

Weight (kDa)

8.74

Isoelectric Point (pI)

51.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 49
AccB7I CCANNNNNTGG 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 149
AgsI TTSAA 3 cut(s) 49, 161, 168
AsuHPI GGTGA 2 cut(s) 19, 45
BbsI GAAGAC 1 cut(s) 71
BciVI GTATCC 1 cut(s) 58
BclI TGATCA 1 cut(s) 16
BfuI GTATCC 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 149
Bse1I ACTGG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 149
Bsp143I GATC 1 cut(s) 16
BsrI ACTGG 1 cut(s) 56
BssMI GATC 1 cut(s) 16
Bst4CI ACNGT 1 cut(s) 96
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 71
BsuI GTATCC 1 cut(s) 58
CviAII CATG 3 cut(s) 22, 115, 186
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
DrdI GACNNNNNNGTC 1 cut(s) 49
DseDI GACNNNNNNGTC 1 cut(s) 49
FaeI CATG 3 cut(s) 25, 118, 189
FaiI YATR 4 cut(s) 23, 71, 116, 187
FatI CATG 3 cut(s) 21, 114, 185
FbaI TGATCA 1 cut(s) 16
FspEI CC 9 cut(s) 8, 47, 69, 82, 96, 101, 135, 156, 159
Hin1II CATG 3 cut(s) 25, 118, 189
HphI GGTGA 2 cut(s) 19, 45
HpyCH4III ACNGT 1 cut(s) 96
HpyCH4V TGCA 3 cut(s) 4, 126, 175
Hsp92II CATG 3 cut(s) 25, 118, 189
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 51
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 1 cut(s) 71
MluCI AATT 3 cut(s) 12, 138, 161
MnlI CCTC 1 cut(s) 93
MseI TTAA 1 cut(s) 98
NdeII GATC 1 cut(s) 16
NlaIII CATG 3 cut(s) 25, 118, 189
NmuCI GTSAC 1 cut(s) 51
PflMI CCANNNNNTGG 1 cut(s) 149
SaqAI TTAA 1 cut(s) 98
Sau3AI GATC 1 cut(s) 16
SetI ASST 1 cut(s) 9
SgeI CNNG 7 cut(s) 17, 34, 61, 68, 127, 161, 180
Sse9I AATT 3 cut(s) 12, 138, 161
SspI AATATT 1 cut(s) 107
TaaI ACNGT 1 cut(s) 96
TasI AATT 3 cut(s) 12, 138, 161
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseFI GTSAC 1 cut(s) 51
Tsp45I GTSAC 1 cut(s) 51
Van91I CCANNNNNTGG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.