Rh1DG165400

Cell division control protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
33906288 .. 33908026
1739 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG165400.1

Sequence Viewer

Length: 246 bp
ATGCAACATTTGAGATTAGCGATTCAACTTGAAAAACAAAGAAAAAAAATCTCTAACGATTGGTTTGGCTCTAGAGGAAGTGACACTGGAGTCACTATCCAGACCTACCAGGTGTCTAATGTTGATAAGGTGAGAATTGATCACATGGCTGTTGCTTTGTCAAAGACATTCAAGTCACTAGTAGTGGATACCATACAATGTCTTCCTCAACATCAACAGGTAACTCTCATGCAAGTATTGTATTGA

Protein Analysis

81

Amino Acids

9.31

Weight (kDa)

9.58

Isoelectric Point (pI)

7.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 89, 172
AgsI TTSAA 3 cut(s) 26, 32, 172
AhlI ACTAGT 1 cut(s) 178
AjnI CCWGG 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 142
BbsI GAAGAC 1 cut(s) 194
BciT130I CCWGG 1 cut(s) 110
BciVI GTATCC 1 cut(s) 181
BclI TGATCA 1 cut(s) 139
BcuI ACTAGT 1 cut(s) 178
BfaI CTAG 2 cut(s) 72, 179
BfuI GTATCC 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BpiI GAAGAC 1 cut(s) 194
BpmI CTGGAG 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 91
Bsp143I GATC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 91
BssMI GATC 1 cut(s) 139
Bst2UI CCWGG 1 cut(s) 110
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BstV2I GAAGAC 1 cut(s) 194
BsuI GTATCC 1 cut(s) 181
BtsIMutI CAGTG 1 cut(s) 84
CsiI ACCWGGT 1 cut(s) 108
CviAII CATG 2 cut(s) 145, 229
CviJI RGCY 2 cut(s) 69, 149
CviKI_1 RGCY 2 cut(s) 69, 149
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
DrdI GACNNNNNNGTC 2 cut(s) 89, 172
DseDI GACNNNNNNGTC 2 cut(s) 89, 172
EcoRII CCWGG 1 cut(s) 108
FaeI CATG 2 cut(s) 148, 232
FaiI YATR 3 cut(s) 146, 194, 230
FatI CATG 2 cut(s) 144, 228
FbaI TGATCA 1 cut(s) 139
FspBI CTAG 2 cut(s) 72, 179
GsuI CTGGAG 1 cut(s) 108
Hin1II CATG 2 cut(s) 148, 232
HinfI GANTC 2 cut(s) 22, 90
HphI GGTGA 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 72, 100
HpyCH4V TGCA 2 cut(s) 4, 232
Hsp92II CATG 2 cut(s) 148, 232
Ksp22I TGATCA 1 cut(s) 139
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 5 cut(s) 72, 95, 113, 122, 203
MabI ACCWGGT 1 cut(s) 108
MaeI CTAG 2 cut(s) 72, 179
MaeIII GTNAC 4 cut(s) 80, 91, 174, 220
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 194
MluCI AATT 1 cut(s) 135
MlyI GAGTC 1 cut(s) 99
MnlI CCTC 2 cut(s) 68, 216
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NdeII GATC 1 cut(s) 139
NlaIII CATG 2 cut(s) 148, 232
NmuCI GTSAC 3 cut(s) 80, 91, 174
PfeI GAWTC 1 cut(s) 22
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
Sau3AI GATC 1 cut(s) 139
SchI GAGTC 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 110
SetI ASST 4 cut(s) 107, 114, 132, 222
SexAI ACCWGGT 1 cut(s) 108
SpeI ACTAGT 1 cut(s) 178
Sse9I AATT 1 cut(s) 135
SspMI CTAG 2 cut(s) 72, 179
StyD4I CCNGG 1 cut(s) 108
TasI AATT 1 cut(s) 135
TfiI GAWTC 1 cut(s) 22
TscAI CASTG 1 cut(s) 91
TseFI GTSAC 3 cut(s) 80, 91, 174
Tsp45I GTSAC 3 cut(s) 80, 91, 174
TspRI CASTG 1 cut(s) 91
XbaI TCTAGA 1 cut(s) 71
XspI CTAG 2 cut(s) 72, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.