RchiOBHm_Chr5g0079191

Cell division control protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
84872323 .. 84875323
3001 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35365

Sequence Viewer

Length: 123 bp
ATGCCTTGCAGATTCTCACCAACAATTTGTGCTACATTGAGAATTGATCACATGGCTGTTGCTTTGTCAAAGACATTGAAGTCACCAGTAGTGGATACCATACAATGTCTTCCTCAACATTAA

Protein Analysis

40

Amino Acids

4.42

Weight (kDa)

8.66

Isoelectric Point (pI)

56.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 79
AgsI TTSAA 1 cut(s) 79
AsuHPI GGTGA 2 cut(s) 9, 75
BbsI GAAGAC 1 cut(s) 101
BciVI GTATCC 1 cut(s) 88
BclI TGATCA 1 cut(s) 46
BfuI GTATCC 1 cut(s) 88
BpiI GAAGAC 1 cut(s) 101
Bse1I ACTGG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 86
Bsp143I GATC 1 cut(s) 46
BsrI ACTGG 1 cut(s) 86
BssMI GATC 1 cut(s) 46
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstV2I GAAGAC 1 cut(s) 101
BsuI GTATCC 1 cut(s) 88
CviAII CATG 1 cut(s) 52
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
DrdI GACNNNNNNGTC 1 cut(s) 79
DseDI GACNNNNNNGTC 1 cut(s) 79
FaeI CATG 1 cut(s) 55
FaiI YATR 2 cut(s) 53, 101
FatI CATG 1 cut(s) 51
FbaI TGATCA 1 cut(s) 46
FspEI CC 6 cut(s) 18, 33, 38, 77, 99, 112
Hin1II CATG 1 cut(s) 55
HinfI GANTC 1 cut(s) 12
HphI GGTGA 2 cut(s) 9, 75
HpyCH4V TGCA 1 cut(s) 9
Hsp92II CATG 1 cut(s) 55
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 81
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 101
MluCI AATT 2 cut(s) 24, 42
MnlI CCTC 1 cut(s) 123
MseI TTAA 1 cut(s) 121
NdeII GATC 1 cut(s) 46
NlaIII CATG 1 cut(s) 55
NmuCI GTSAC 1 cut(s) 81
PfeI GAWTC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 121
Sau3AI GATC 1 cut(s) 46
SgeI CNNG 3 cut(s) 18, 64, 98
Sse9I AATT 2 cut(s) 24, 42
TasI AATT 2 cut(s) 24, 42
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 121
Tru9I TTAA 1 cut(s) 121
TseFI GTSAC 1 cut(s) 81
Tsp45I GTSAC 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.