RchiOBHm_Chr2g0152821

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
70218694 .. 70220087
1394 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52194

Sequence Viewer

Length: 153 bp
ATGGGTAACCAAGATTTGAATTCGAACATTGGAGCTGTGGATTTGGGATTGAAGAAAAAATTGTCAAAATTGGGGCTAAGAAGCTTTCTAGGACTTTGGTCTGTAAGGCTGTTCTTTGGTGGAAGATATGGGGGTCTAAGATTTGGGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.47

Weight (kDa)

11.05

Isoelectric Point (pI)

30.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 19
AgsI TTSAA 2 cut(s) 19, 52
AluBI AGCT 2 cut(s) 35, 84
AluI AGCT 2 cut(s) 35, 84
ApoI RAATTY 1 cut(s) 19
AsuII TTCGAA 1 cut(s) 23
BfaI CTAG 1 cut(s) 89
BoxI GACNNNNGTC 1 cut(s) 97
Bpu14I TTCGAA 1 cut(s) 23
Bsp119I TTCGAA 1 cut(s) 23
BspT104I TTCGAA 1 cut(s) 23
BstBI TTCGAA 1 cut(s) 23
BstDEI CTNAG 2 cut(s) 77, 137
BstEII GGTNACC 1 cut(s) 5
BstPAI GACNNNNGTC 1 cut(s) 97
BstPI GGTNACC 1 cut(s) 5
CviJI RGCY 4 cut(s) 35, 76, 84, 109
CviKI_1 RGCY 4 cut(s) 35, 76, 84, 109
DdeI CTNAG 2 cut(s) 77, 137
Eco91I GGTNACC 1 cut(s) 5
EcoO65I GGTNACC 1 cut(s) 5
EcoRI GAATTC 1 cut(s) 19
FaiI YATR 1 cut(s) 129
FspBI CTAG 1 cut(s) 89
HindIII AAGCTT 1 cut(s) 82
HpyF3I CTNAG 2 cut(s) 77, 137
LmnI GCTCC 1 cut(s) 32
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 5
MboII GAAGA 2 cut(s) 64, 135
MluCI AATT 3 cut(s) 19, 59, 68
NspV TTCGAA 1 cut(s) 23
PshAI GACNNNNGTC 1 cut(s) 97
PspEI GGTNACC 1 cut(s) 5
SetI ASST 2 cut(s) 37, 86
SfuI TTCGAA 1 cut(s) 23
SgeI CNNG 2 cut(s) 23, 101
Sse9I AATT 3 cut(s) 19, 59, 68
SspMI CTAG 1 cut(s) 89
TaqI TCGA 1 cut(s) 23
TasI AATT 3 cut(s) 19, 59, 68
XapI RAATTY 1 cut(s) 19
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.