Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5D

Orthogroup ID

OG0007548

Physical Location & Seq

Genomic Coordinates Reverse (-)

28751398 .. 28754283

Gene Structure 2886 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5DG249400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 585 bp

ATGGGTATTAGGCTCAAGAGAATGGTGGTCTCCGATGAGAGCCTTGAGTTGCTTTCCAGGTATGGCCAAGAAATTATGGCAGTGAAGGGGAGGGTCTTGCAAGTTCCACCAGTGTTCAGGCATCGTTTGGACATATCATACAATCAAACCACTGGTGGGATTCCATATAACATTGGATTTTTACAAGTGGCTACCCTGTCGCTACAAGGCAATAGACTGACTGGAAAGATTCCTGAGGTTATTGGTTTAATGCAAGCCCTTGCTGTTTTGGATTTAAGTGAGAATGAACTTGTAGGGCCAATTCCACCGATACTGGGCAATTTATCATACACTAGGAAACTATACCTGCATGGTAACAAGTTGACTGGGACAATTCCTCCTAAGCTTGGCAATATGTCAACGCTTAGCTATTTTCTCTTTGCTTATTATCTCTGCGAGCAATTAAATGACAACAATCTGGTTGGTAGAATTCCTGGTGAGCTTGGGAAGTTGTATCAGTTGTTTGAATTGAATCTTGCCAACAATGATCTGCAAGGTCCCATCCCACATGACATCGGTTCCTGCACTGCCTTGAATCAATTGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04016 map04016

Pfam Domains

Protein Families

LRRNT_2 LRR_4 LRR_6 LRR_8 Pkinase

Protein Analysis

194

Amino Acids

21.47

Weight (kDa)

7.76

Isoelectric Point (pI)

28.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007548)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0152821 RchiOBHm_Chr3g0495421
rosa_laevigata	RLG00000002537 RLG00000013116 RLG00000035479
rosa_multiflora	Rmu_sc0000185.1_g000009 Rmu_sc0000662.1_g000017 Rmu_sc0002244.1_g000021 Rmu_sc0002858.1_g000009 Rmu_sc0006805.1_g000008
rosa_roxburghii	Rroxscaffold_1G00035930 Rroxscaffold_1G00042630 Rroxscaffold_5G00344740
rosa_samantha	Rh2AG316200 Rh2AG528400 Rh2BG485600 Rh2CG229200 Rh2CG512700 Rh2DG403000 Rh2DG494800 Rh3DG247800 Rh4BG207000 Rh5AG221400 Rh5DG249400 Rh6BG071800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	354
AcoI	YGGCCR	1 cut(s)	64
AcsI	RAATTY	1 cut(s)	468
AfiI	CCNNNNNNNGG	3 cut(s)	156, 314, 386
AgsI	TTSAA	3 cut(s)	506, 511, 574
AjnI	CCWGG	2 cut(s)	56, 472
AluBI	AGCT	3 cut(s)	385, 408, 481
AluI	AGCT	3 cut(s)	385, 408, 481
Alw26I	GTCTC	1 cut(s)	34
AoxI	GGCC	2 cut(s)	64, 296
ApoI	RAATTY	1 cut(s)	468
AspS9I	GGNCC	2 cut(s)	296, 536
AsuHPI	GGTGA	1 cut(s)	488
AvaII	GGWCC	1 cut(s)	536
AxyI	CCTNAGG	1 cut(s)	234
BalI	TGGCCA	1 cut(s)	66
BccI	CCATC	1 cut(s)	548
BciT130I	CCWGG	2 cut(s)	58, 474
BcoDI	GTCTC	1 cut(s)	34
BfaI	CTAG	1 cut(s)	333
BfuAI	ACCTGC	1 cut(s)	354
BlpI	GCTNAGC	1 cut(s)	404
Bme1390I	CCNGG	2 cut(s)	58, 474
Bme18I	GGWCC	1 cut(s)	536
BmgT120I	GGNCC	2 cut(s)	296, 536
BmiI	GGNNCC	2 cut(s)	538, 559
BmrFI	CCNGG	2 cut(s)	58, 474
BmrI	ACTGGG	2 cut(s)	323, 375
BmsI	GCATC	1 cut(s)	130
BmuI	ACTGGG	2 cut(s)	323, 375
Bpu10I	CCTNAGC	1 cut(s)	381
Bpu1102I	GCTNAGC	1 cut(s)	404
BpuEI	CTTGAG	1 cut(s)	65
BsaI	GGTCTC	1 cut(s)	34
BsaXI	ACNNNNNCTCC	2 cut(s)	361, 391
Bsc4I	CCNNNNNNNGG	3 cut(s)	156, 314, 386
Bse1I	ACTGG	5 cut(s)	110, 157, 226, 318, 370
Bse21I	CCTNAGG	1 cut(s)	234
BseBI	CCWGG	2 cut(s)	58, 474
BseGI	GGATG	1 cut(s)	540
BseLI	CCNNNNNNNGG	3 cut(s)	156, 314, 386
BseMII	CTCAG	1 cut(s)	225
BseNI	ACTGG	5 cut(s)	110, 157, 226, 318, 370
BsgI	GTGCAG	1 cut(s)	547
BshFI	GGCC	2 cut(s)	66, 298
BslFI	GGGAC	2 cut(s)	382, 522
BslI	CCNNNNNNNGG	3 cut(s)	156, 314, 386
BsmAI	GTCTC	1 cut(s)	34
BsmFI	GGGAC	2 cut(s)	382, 522
BsnI	GGCC	2 cut(s)	66, 298
Bso31I	GGTCTC	1 cut(s)	34
Bsp143I	GATC	1 cut(s)	526
Bsp1720I	GCTNAGC	1 cut(s)	404
BspANI	GGCC	2 cut(s)	66, 298
BspCNI	CTCAG	1 cut(s)	226
BspLI	GGNNCC	2 cut(s)	538, 559
BspMI	ACCTGC	1 cut(s)	354
BspTNI	GGTCTC	1 cut(s)	34
BsrI	ACTGG	5 cut(s)	110, 157, 226, 318, 370
BssMI	GATC	1 cut(s)	526
Bst2UI	CCWGG	2 cut(s)	58, 474
BstC8I	GCNNGC	2 cut(s)	255, 437
BstDEI	CTNAG	3 cut(s)	234, 381, 404
BstF5I	GGATG	1 cut(s)	540
BstKTI	GATC	1 cut(s)	529
BstMAI	GTCTC	1 cut(s)	34
BstMBI	GATC	1 cut(s)	526
BstNI	CCWGG	2 cut(s)	58, 474
BstSCI	CCNGG	2 cut(s)	56, 472
Bsu36I	CCTNAGG	1 cut(s)	234
BsuRI	GGCC	2 cut(s)	66, 298
BtsCI	GGATG	1 cut(s)	540
BtsI	GCAGTG	2 cut(s)	87, 564
BtsIMutI	CAGTG	4 cut(s)	87, 117, 150, 564
BveI	ACCTGC	1 cut(s)	354
Cac8I	GCNNGC	2 cut(s)	255, 437
Cfr13I	GGNCC	2 cut(s)	296, 536
CviAII	CATG	2 cut(s)	350, 548
CviJI	RGCY	9 cut(s)	13, 42, 66, 191, 257, 298, 385, 408, 481
CviKI_1	RGCY	9 cut(s)	13, 42, 66, 191, 257, 298, 385, 408, 481
DdeI	CTNAG	3 cut(s)	234, 381, 404
DpnI	GATC	1 cut(s)	528
DpnII	GATC	1 cut(s)	526
EaeI	YGGCCR	1 cut(s)	64
Eco31I	GGTCTC	1 cut(s)	34
Eco47I	GGWCC	1 cut(s)	536
Eco81I	CCTNAGG	1 cut(s)	234
EcoO109I	RGGNCCY	1 cut(s)	536
EcoRI	GAATTC	1 cut(s)	468
EcoRII	CCWGG	2 cut(s)	56, 472
FaeI	CATG	2 cut(s)	353, 551
FaqI	GGGAC	2 cut(s)	382, 522
FatI	CATG	2 cut(s)	349, 547
FokI	GGATG	1 cut(s)	527
FspBI	CTAG	1 cut(s)	333
HaeIII	GGCC	2 cut(s)	66, 298
Hin1II	CATG	2 cut(s)	353, 551
HincII	GTYRAC	2 cut(s)	363, 399
HindII	GTYRAC	2 cut(s)	363, 399
HindIII	AAGCTT	1 cut(s)	383
HinfI	GANTC	4 cut(s)	160, 229, 511, 574
HphI	GGTGA	1 cut(s)	488
Hpy166II	GTNNAC	2 cut(s)	363, 399
Hpy188I	TCNGA	1 cut(s)	34
Hpy188III	TCNNGA	2 cut(s)	16, 233
Hpy8I	GTNNAC	2 cut(s)	363, 399
HpyAV	CCTTC	1 cut(s)	79
HpyCH4V	TGCA	5 cut(s)	100, 253, 349, 532, 564
HpyF3I	CTNAG	3 cut(s)	234, 381, 404
Hsp92II	CATG	2 cut(s)	353, 551
Kzo9I	GATC	1 cut(s)	526
LweI	GCATC	1 cut(s)	130
MaeI	CTAG	1 cut(s)	333
MaeIII	GTNAC	1 cut(s)	353
MalI	GATC	1 cut(s)	528
MboI	GATC	1 cut(s)	526
MfeI	CAATTG	1 cut(s)	578
MlsI	TGGCCA	1 cut(s)	66
MluCI	AATT	8 cut(s)	72, 300, 319, 372, 440, 468, 506, 578
MluNI	TGGCCA	1 cut(s)	66
MnlI	CCTC	3 cut(s)	84, 229, 387
Mox20I	TGGCCA	1 cut(s)	66
MscI	TGGCCA	1 cut(s)	66
MseI	TTAA	3 cut(s)	248, 275, 443
Msp20I	TGGCCA	1 cut(s)	66
MspR9I	CCNGG	2 cut(s)	58, 474
MunI	CAATTG	1 cut(s)	578
MvaI	CCWGG	2 cut(s)	58, 474
NdeII	GATC	1 cut(s)	526
NlaIII	CATG	2 cut(s)	353, 551
NlaIV	GGNNCC	2 cut(s)	538, 559
PfeI	GAWTC	4 cut(s)	160, 229, 511, 574
PpuMI	RGGWCCY	1 cut(s)	536
Psp5II	RGGWCCY	1 cut(s)	536
Psp6I	CCWGG	2 cut(s)	56, 472
PspGI	CCWGG	2 cut(s)	56, 472
PspN4I	GGNNCC	2 cut(s)	538, 559
PspPI	GGNCC	2 cut(s)	296, 536
PspPPI	RGGWCCY	1 cut(s)	536
SaqAI	TTAA	3 cut(s)	248, 275, 443
Sau3AI	GATC	1 cut(s)	526
Sau96I	GGNCC	2 cut(s)	296, 536
ScrFI	CCNGG	2 cut(s)	58, 474
SetI	ASST	7 cut(s)	62, 240, 348, 387, 410, 483, 538
SfaNI	GCATC	1 cut(s)	130
SinI	GGWCC	1 cut(s)	536
SmlI	CTYRAG	2 cut(s)	14, 44
SmoI	CTYRAG	2 cut(s)	14, 44
Sse9I	AATT	8 cut(s)	72, 300, 319, 372, 440, 468, 506, 578
SspMI	CTAG	1 cut(s)	333
StyD4I	CCNGG	2 cut(s)	56, 472
TasI	AATT	8 cut(s)	72, 300, 319, 372, 440, 468, 506, 578
TfiI	GAWTC	4 cut(s)	160, 229, 511, 574
Tru1I	TTAA	3 cut(s)	248, 275, 443
Tru9I	TTAA	3 cut(s)	248, 275, 443
TscAI	CASTG	4 cut(s)	87, 117, 157, 571
TspDTI	ATGAA	1 cut(s)	300
TspRI	CASTG	4 cut(s)	87, 117, 157, 571
VpaK11BI	GGWCC	1 cut(s)	536
XapI	RAATTY	1 cut(s)	468
XspI	CTAG	1 cut(s)	333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.