Rh2AG316200

protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0007548
Physical Location & Seq
Reverse (-)
41480587 .. 41481028
442 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG316200.1

Sequence Viewer

Length: 312 bp
ATGGTGGTCTCCGATGAAAGCCTTGAGTTGCTTTCCAGGTATGGCCAAGAAATTATGGCAGTGAAGGGTCTTGCAAGTTCCACCAGTGTTCAGGCATCGTTTGTAAGAGGTGTTCTTGAGAAAACTAGAGTTGAGCCACAAGTGGAGAGAATTGGTAAATACGAAAGTGCTGGTGAGCAACTTGCGCGTATGACCATGTCCGAAGAAAATTGTGAGATGCTAACAGCATTGCTCGATAACATATATGGGAACTGGCTGGACATAATTTCTTCTACAAGAGGTGTTTTGAGATTTGCTATTTGGCTAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S49

Protein Analysis

103

Amino Acids

11.53

Weight (kDa)

4.78

Isoelectric Point (pI)

37.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S49 PF01343 30 - 95 5.7e-07 Peptidase family S49
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 187
AcoI YGGCCR 1 cut(s) 43
AjnI CCWGG 1 cut(s) 35
Alw26I GTCTC 1 cut(s) 13
AoxI GGCC 1 cut(s) 43
AspLEI GCGC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 185
BalI TGGCCA 1 cut(s) 45
BciT130I CCWGG 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 13
BfaI CTAG 1 cut(s) 126
Bme1390I CCNGG 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 37
BmsI GCATC 2 cut(s) 104, 207
BpuEI CTTGAG 2 cut(s) 44, 137
BsaI GGTCTC 1 cut(s) 13
Bse1I ACTGG 2 cut(s) 84, 257
Bse3DI GCAATG 1 cut(s) 227
BseBI CCWGG 1 cut(s) 37
BseMI GCAATG 1 cut(s) 227
BseNI ACTGG 2 cut(s) 84, 257
Bsh1236I CGCG 1 cut(s) 187
BshFI GGCC 1 cut(s) 45
BsmAI GTCTC 1 cut(s) 13
BsnI GGCC 1 cut(s) 45
Bso31I GGTCTC 1 cut(s) 13
BspANI GGCC 1 cut(s) 45
BspFNI CGCG 1 cut(s) 187
BspTNI GGTCTC 1 cut(s) 13
BsrDI GCAATG 1 cut(s) 227
BsrI ACTGG 2 cut(s) 84, 257
Bst2UI CCWGG 1 cut(s) 37
BstFNI CGCG 1 cut(s) 187
BstHHI GCGC 1 cut(s) 187
BstMAI GTCTC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNI CCWGG 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 35
BstUI CGCG 1 cut(s) 187
BsuRI GGCC 1 cut(s) 45
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 2 cut(s) 66, 91
CfoI GCGC 1 cut(s) 187
CviAII CATG 1 cut(s) 196
CviJI RGCY 5 cut(s) 21, 45, 136, 256, 304
CviKI_1 RGCY 5 cut(s) 21, 45, 136, 256, 304
EaeI YGGCCR 1 cut(s) 43
Eco31I GGTCTC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 35
FaeI CATG 1 cut(s) 199
FaiI YATR 8 cut(s) 42, 56, 191, 197, 242, 244, 246, 263
FatI CATG 1 cut(s) 195
FspBI CTAG 1 cut(s) 126
GlaI GCGC 1 cut(s) 186
HaeIII GGCC 1 cut(s) 45
HhaI GCGC 1 cut(s) 187
Hin1II CATG 1 cut(s) 199
Hin6I GCGC 1 cut(s) 185
HinP1I GCGC 1 cut(s) 185
HphI GGTGA 1 cut(s) 185
Hpy188I TCNGA 3 cut(s) 13, 202, 311
Hpy188III TCNNGA 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
Hsp92II CATG 1 cut(s) 199
HspAI GCGC 1 cut(s) 185
LpnPI CCDG 7 cut(s) 22, 49, 77, 97, 156, 238, 242
LweI GCATC 2 cut(s) 104, 207
MaeI CTAG 1 cut(s) 126
MboII GAAGA 2 cut(s) 215, 261
MlsI TGGCCA 1 cut(s) 45
MluCI AATT 4 cut(s) 51, 150, 208, 264
MluNI TGGCCA 1 cut(s) 45
MnlI CCTC 2 cut(s) 101, 272
Mox20I TGGCCA 1 cut(s) 45
MscI TGGCCA 1 cut(s) 45
Msp20I TGGCCA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 37
MvaI CCWGG 1 cut(s) 37
MvnI CGCG 1 cut(s) 187
MwoI GCNNNNNNNGC 1 cut(s) 184
NlaIII CATG 1 cut(s) 199
PflFI GACNNNGTC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 35
PspGI CCWGG 1 cut(s) 35
PsrI GAACNNNNNNTAC 2 cut(s) 96, 128
PsyI GACNNNGTC 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 37
SetI ASST 3 cut(s) 41, 112, 283
SfaNI GCATC 2 cut(s) 104, 207
SmlI CTYRAG 2 cut(s) 23, 116
SmoI CTYRAG 2 cut(s) 23, 116
Sse9I AATT 4 cut(s) 51, 150, 208, 264
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 35
TaqI TCGA 1 cut(s) 234
TasI AATT 4 cut(s) 51, 150, 208, 264
TscAI CASTG 2 cut(s) 66, 91
TspDTI ATGAA 1 cut(s) 30
TspRI CASTG 2 cut(s) 66, 91
Tth111I GACNNNGTC 1 cut(s) 196
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.