RchiOBHm_Chr3g0465921

Glucose-induced degradation protein 4 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0005099
Physical Location & Seq
Forward (+)
12515534 .. 12517868
2335 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43203

Sequence Viewer

Length: 309 bp
ATGGAAGCACTTAATGTTCCCATGGCTGACACACCAGTCGTCACCTTTTGGGAAAGGGAGATTGTTGACACCAAGAATTATACTTTCTTCACTGAGAAGTGGGAAGCAACACAAGATGATGATATAAGGCACTGGACCAAATTTCCTTCTTTTTCTGCTCTATTGAGCCAAGTGGAAGTTGGTGGCAAATCATTAGATCTCAGCAACTATCCATACATATTCATGAGATGGAAGGAGCAATACTTTGTGAATGTTGGCACAGACTGGTTTGACTGTAGCCGGCTTTTACCATGTGTGTTTCTCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Vac_ImportDeg

Protein Analysis

102

Amino Acids

12.13

Weight (kDa)

4.56

Isoelectric Point (pI)

27.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Vac_ImportDeg PF09783 2 - 84 1.2e-20 Vacuolar import and degradation protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 140
ApoI RAATTY 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 135
AsuHPI GGTGA 1 cut(s) 34
AvaII GGWCC 1 cut(s) 135
BarI GAAGNNNNNNTAC 2 cut(s) 224, 256
BccI CCATC 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 274
BglII AGATCT 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 21
Bse118I RCCGGY 1 cut(s) 279
Bse1I ACTGG 3 cut(s) 35, 137, 269
BseDI CCNNGG 1 cut(s) 21
BseMII CTCAG 2 cut(s) 84, 214
BseNI ACTGG 3 cut(s) 35, 137, 269
BsiSI CCGG 1 cut(s) 280
Bsp143I GATC 1 cut(s) 196
Bsp19I CCATGG 1 cut(s) 21
BspCNI CTCAG 2 cut(s) 85, 213
BspHI TCATGA 1 cut(s) 222
BsrFI RCCGGY 1 cut(s) 279
BsrI ACTGG 3 cut(s) 35, 137, 269
BssAI RCCGGY 1 cut(s) 279
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 21
Bst4CI ACNGT 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 281
BstDEI CTNAG 2 cut(s) 93, 200
BstDSI CCRYGG 1 cut(s) 21
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 274
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BtgI CCRYGG 1 cut(s) 21
BtsIMutI CAGTG 2 cut(s) 90, 130
Cac8I GCNNGC 1 cut(s) 281
CciI TCATGA 1 cut(s) 222
Cfr10I RCCGGY 1 cut(s) 279
Cfr13I GGNCC 1 cut(s) 135
CviAII CATG 4 cut(s) 22, 223, 291, 304
CviJI RGCY 4 cut(s) 26, 168, 279, 283
CviKI_1 RGCY 4 cut(s) 26, 168, 279, 283
DdeI CTNAG 2 cut(s) 93, 200
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
DrdI GACNNNNNNGTC 1 cut(s) 35
DseDI GACNNNNNNGTC 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 4 cut(s) 25, 226, 294, 307
FaiI YATR 8 cut(s) 23, 81, 125, 214, 218, 224, 292, 305
FatI CATG 4 cut(s) 21, 222, 290, 303
HapII CCGG 1 cut(s) 280
Hin1II CATG 4 cut(s) 25, 226, 294, 307
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HpaII CCGG 1 cut(s) 280
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 223
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 2 cut(s) 156, 226
HpyCH4III ACNGT 1 cut(s) 275
HpyF3I CTNAG 2 cut(s) 93, 200
Hsp92II CATG 4 cut(s) 25, 226, 294, 307
KroI GCCGGC 1 cut(s) 279
KroNI GCCGGC 1 cut(s) 281
Kzo9I GATC 1 cut(s) 196
LmnI GCTCC 1 cut(s) 235
LpnPI CCDG 4 cut(s) 48, 118, 250, 293
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 1 cut(s) 79
MflI RGATCY 1 cut(s) 196
MluCI AATT 2 cut(s) 76, 140
MroNI GCCGGC 1 cut(s) 279
MseI TTAA 1 cut(s) 12
MslI CAYNNNNRTG 1 cut(s) 221
MspI CCGG 1 cut(s) 280
NaeI GCCGGC 1 cut(s) 281
NcoI CCATGG 1 cut(s) 21
NdeII GATC 1 cut(s) 196
NgoMIV GCCGGC 1 cut(s) 279
NlaIII CATG 4 cut(s) 25, 226, 294, 307
NmuCI GTSAC 1 cut(s) 40
PagI TCATGA 1 cut(s) 222
PdiI GCCGGC 1 cut(s) 281
PspPI GGNCC 1 cut(s) 135
PsuI RGATCY 1 cut(s) 196
RseI CAYNNNNRTG 1 cut(s) 221
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 135
SetI ASST 1 cut(s) 47
SfcI CTRYAG 1 cut(s) 274
SinI GGWCC 1 cut(s) 135
SmiMI CAYNNNNRTG 1 cut(s) 221
Sse9I AATT 2 cut(s) 76, 140
StyI CCWWGG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 275
TasI AATT 2 cut(s) 76, 140
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 2 cut(s) 97, 137
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 211
TspRI CASTG 2 cut(s) 97, 137
VpaK11BI GGWCC 1 cut(s) 135
XapI RAATTY 1 cut(s) 140
XcmI CCANNNNNNNNNTGG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.