Rw3G011740

Glucose-induced degradation protein 4 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0005099
Physical Location & Seq
Forward (+)
11534865 .. 11535999
1135 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G011740.1

Sequence Viewer

Length: 237 bp
ATGGAAGCACTTAATGTTCCCATGGCTGACACACCAGTCGTCACCTTTTGGGAAGGGGAGATTGTTGACACCAAGAATTATACTTTCTTCACTGAGAAGTGGGAAGCAACACACGATGGTGATATAAGGCACTGGACCAAATTTCCTTCTTTTTCTGCTCGATCTTTTGTGGAAGTTGATGGTGGCAAATCATTAGATCTCAGCAACTATCCATACATATTCATGGTAAGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Vac_ImportDeg

Protein Analysis

78

Amino Acids

9.01

Weight (kDa)

4.57

Isoelectric Point (pI)

23.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Vac_ImportDeg PF09783 2 - 75 1.6e-14 Vacuolar import and degradation protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 140
AleI CACNNNNGTG 1 cut(s) 117
ApoI RAATTY 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 135
AsuHPI GGTGA 2 cut(s) 34, 131
AvaII GGWCC 1 cut(s) 135
BccI CCATC 2 cut(s) 110, 173
BglII AGATCT 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 21
Bse1I ACTGG 2 cut(s) 35, 137
BseDI CCNNGG 1 cut(s) 21
BseMII CTCAG 2 cut(s) 84, 214
BseNI ACTGG 2 cut(s) 35, 137
Bsp143I GATC 2 cut(s) 161, 196
Bsp19I CCATGG 1 cut(s) 21
BspCNI CTCAG 2 cut(s) 85, 213
BsrI ACTGG 2 cut(s) 35, 137
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 2 cut(s) 161, 196
BssT1I CCWWGG 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 93, 200
BstDSI CCRYGG 1 cut(s) 21
BstKTI GATC 2 cut(s) 164, 199
BstMBI GATC 2 cut(s) 161, 196
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BtgI CCRYGG 1 cut(s) 21
BtsIMutI CAGTG 2 cut(s) 90, 130
Cfr13I GGNCC 1 cut(s) 135
CviAII CATG 2 cut(s) 22, 223
CviJI RGCY 1 cut(s) 26
CviKI_1 RGCY 1 cut(s) 26
DdeI CTNAG 2 cut(s) 93, 200
DpnI GATC 2 cut(s) 163, 198
DpnII GATC 2 cut(s) 161, 196
DrdI GACNNNNNNGTC 1 cut(s) 35
DseDI GACNNNNNNGTC 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 2 cut(s) 25, 226
FaiI YATR 6 cut(s) 23, 81, 125, 214, 218, 224
FatI CATG 2 cut(s) 21, 222
Hin1II CATG 2 cut(s) 25, 226
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HphI GGTGA 2 cut(s) 34, 131
Hpy166II GTNNAC 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 2 cut(s) 47, 156
HpyF3I CTNAG 2 cut(s) 93, 200
Hsp92II CATG 2 cut(s) 25, 226
Kzo9I GATC 2 cut(s) 161, 196
LpnPI CCDG 2 cut(s) 48, 118
MaeIII GTNAC 1 cut(s) 40
MalI GATC 2 cut(s) 163, 198
MboI GATC 2 cut(s) 161, 196
MboII GAAGA 1 cut(s) 79
MflI RGATCY 1 cut(s) 196
MluCI AATT 2 cut(s) 76, 140
MseI TTAA 1 cut(s) 12
MslI CAYNNNNRTG 2 cut(s) 117, 221
NcoI CCATGG 1 cut(s) 21
NdeII GATC 2 cut(s) 161, 196
NlaIII CATG 2 cut(s) 25, 226
NmuCI GTSAC 1 cut(s) 40
OliI CACNNNNGTG 1 cut(s) 117
PspPI GGNCC 1 cut(s) 135
PsuI RGATCY 1 cut(s) 196
RseI CAYNNNNRTG 2 cut(s) 117, 221
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 2 cut(s) 161, 196
Sau96I GGNCC 1 cut(s) 135
SetI ASST 1 cut(s) 47
SgeI CNNG 6 cut(s) 34, 47, 85, 125, 145, 171
SinI GGWCC 1 cut(s) 135
SmiMI CAYNNNNRTG 2 cut(s) 117, 221
Sse9I AATT 2 cut(s) 76, 140
StyI CCWWGG 1 cut(s) 21
TaqI TCGA 1 cut(s) 160
TasI AATT 2 cut(s) 76, 140
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 2 cut(s) 97, 137
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 211
TspRI CASTG 2 cut(s) 97, 137
VpaK11BI GGWCC 1 cut(s) 135
XapI RAATTY 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.