Rmu_sc0009386.1_g000003

Glucose-induced degradation protein 4 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009386.1
Physical Location & Seq
Reverse (-)
7789 .. 10518
2730 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009386.1_g000003.1.cds

Sequence Viewer

Length: 450 bp
atggaagcacttaatgttcccatggctgacacaccagtcgtcaccttttgggaaggggagattgttgacaccaagaattatactttcttcactgagaagtgggaagcaacacacgacggtgatataaggcactggaccaaatttccttctttttctgctcttttgagccgagtggaagttgatggtggcaaatcattagatctcagcaactatccatacatattcatgagacggaagaagcaatacttcgtgaatgttggcacagactccggtttgactatagctggcttttaccatgtgtgtttctcatgcagtgatggctctatcaacggcttctattatgatcctaatagcagaaggatttttgctcaagttctgcagctattcaatccttggtccaagctgctcaagatgtcgaacctaggccaagctgcatctatagggatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

149

Amino Acids

16.97

Weight (kDa)

6.27

Isoelectric Point (pI)

38.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 35
AclWI GGATC 1 cut(s) 338
AcsI RAATTY 1 cut(s) 140
AgsI TTSAA 1 cut(s) 388
AleI CACNNNNGTG 1 cut(s) 117
AluBI AGCT 4 cut(s) 284, 382, 403, 431
AluI AGCT 4 cut(s) 284, 382, 403, 431
Alw26I GTCTC 1 cut(s) 223
AlwI GGATC 1 cut(s) 338
AoxI GGCC 1 cut(s) 424
ApeKI GCWGC 3 cut(s) 379, 403, 431
ApoI RAATTY 1 cut(s) 140
AspA2I CCTAGG 1 cut(s) 421
AspS9I GGNCC 2 cut(s) 135, 396
AsuHPI GGTGA 2 cut(s) 34, 131
AvaII GGWCC 2 cut(s) 135, 396
AvrII CCTAGG 1 cut(s) 421
BarI GAAGNNNNNNTAC 2 cut(s) 227, 259
BbvI GCAGC 3 cut(s) 390, 391, 418
BccI CCATC 2 cut(s) 176, 311
BceAI ACGGC 1 cut(s) 346
BcoDI GTCTC 1 cut(s) 223
BfaI CTAG 2 cut(s) 422, 448
BfmI CTRYAG 3 cut(s) 279, 377, 438
BglII AGATCT 1 cut(s) 199
BisI GCNGC 3 cut(s) 380, 404, 432
BlnI CCTAGG 1 cut(s) 421
BlsI GCNGC 3 cut(s) 381, 405, 433
Bme18I GGWCC 2 cut(s) 135, 396
BmgT120I GGNCC 2 cut(s) 135, 396
BmsI GCATC 1 cut(s) 443
BpuEI CTTGAG 2 cut(s) 354, 392
BsaJI CCNNGG 3 cut(s) 21, 392, 421
BsaWI WCCGGW 1 cut(s) 269
Bse1I ACTGG 2 cut(s) 35, 137
BseDI CCNNGG 3 cut(s) 21, 392, 421
BseMII CTCAG 2 cut(s) 84, 217
BseNI ACTGG 2 cut(s) 35, 137
BseXI GCAGC 3 cut(s) 390, 391, 418
BshFI GGCC 1 cut(s) 426
BsiSI CCGG 1 cut(s) 270
BsmAI GTCTC 1 cut(s) 223
BsmBI CGTCTC 1 cut(s) 223
BsnI GGCC 1 cut(s) 426
Bsp143I GATC 3 cut(s) 199, 343, 444
Bsp19I CCATGG 1 cut(s) 21
BspANI GGCC 1 cut(s) 426
BspCNI CTCAG 2 cut(s) 85, 216
BspHI TCATGA 1 cut(s) 225
BspMAI CTGCAG 1 cut(s) 381
BspPI GGATC 1 cut(s) 338
BsrI ACTGG 2 cut(s) 35, 137
BssECI CCNNGG 3 cut(s) 21, 392, 421
BssMI GATC 3 cut(s) 199, 343, 444
BssT1I CCWWGG 3 cut(s) 21, 392, 421
Bst4CI ACNGT 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 286
BstDEI CTNAG 2 cut(s) 93, 203
BstDSI CCRYGG 1 cut(s) 21
BstKTI GATC 3 cut(s) 202, 346, 447
BstMAI GTCTC 1 cut(s) 223
BstMBI GATC 3 cut(s) 199, 343, 444
BstMWI GCNNNNNNNGC 1 cut(s) 318
BstSFI CTRYAG 3 cut(s) 279, 377, 438
BstV1I GCAGC 3 cut(s) 390, 391, 418
BstX2I RGATCY 2 cut(s) 199, 444
BstYI RGATCY 2 cut(s) 199, 444
BsuRI GGCC 1 cut(s) 426
BtgI CCRYGG 1 cut(s) 21
BtsI GCAGTG 1 cut(s) 319
BtsIMutI CAGTG 3 cut(s) 90, 130, 319
Cac8I GCNNGC 1 cut(s) 286
CciI TCATGA 1 cut(s) 225
Cfr13I GGNCC 2 cut(s) 135, 396
CviAII CATG 4 cut(s) 22, 226, 296, 309
DdeI CTNAG 2 cut(s) 93, 203
DpnI GATC 3 cut(s) 201, 345, 446
DpnII GATC 3 cut(s) 199, 343, 444
DrdI GACNNNNNNGTC 1 cut(s) 35
DseDI GACNNNNNNGTC 1 cut(s) 35
Eco130I CCWWGG 3 cut(s) 21, 392, 421
Eco47I GGWCC 2 cut(s) 135, 396
EcoT14I CCWWGG 3 cut(s) 21, 392, 421
ErhI CCWWGG 3 cut(s) 21, 392, 421
Esp3I CGTCTC 1 cut(s) 223
FaeI CATG 4 cut(s) 25, 229, 299, 312
FalI AAGNNNNNCTT 2 cut(s) 230, 262
FatI CATG 4 cut(s) 21, 225, 295, 308
Fnu4HI GCNGC 3 cut(s) 380, 404, 432
Fsp4HI GCNGC 3 cut(s) 380, 404, 432
FspBI CTAG 2 cut(s) 422, 448
GluI GCNGC 3 cut(s) 380, 404, 432
HaeIII GGCC 1 cut(s) 426
HapII CCGG 1 cut(s) 270
Hin1II CATG 4 cut(s) 25, 229, 299, 312
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HinfI GANTC 1 cut(s) 266
HpaII CCGG 1 cut(s) 270
HphI GGTGA 2 cut(s) 34, 131
Hpy166II GTNNAC 1 cut(s) 67
Hpy188III TCNNGA 3 cut(s) 226, 250, 409
Hpy8I GTNNAC 1 cut(s) 67
Hpy99I CGWCG 1 cut(s) 119
HpyAV CCTTC 3 cut(s) 47, 156, 351
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4V TGCA 3 cut(s) 312, 379, 434
HpyF10VI GCNNNNNNNGC 1 cut(s) 318
HpyF3I CTNAG 2 cut(s) 93, 203
Hsp92II CATG 4 cut(s) 25, 229, 299, 312
Kzo9I GATC 3 cut(s) 199, 343, 444
LpnPI CCDG 4 cut(s) 48, 118, 270, 283
Lsp1109I GCAGC 3 cut(s) 390, 391, 418
LweI GCATC 1 cut(s) 443
MaeI CTAG 2 cut(s) 422, 448
MaeIII GTNAC 1 cut(s) 40
MalI GATC 3 cut(s) 201, 345, 446
MboI GATC 3 cut(s) 199, 343, 444
MboII GAAGA 2 cut(s) 79, 247
MflI RGATCY 2 cut(s) 199, 444
MluCI AATT 2 cut(s) 76, 140
MlyI GAGTC 1 cut(s) 260
MseI TTAA 1 cut(s) 12
MslI CAYNNNNRTG 2 cut(s) 117, 224
MspI CCGG 1 cut(s) 270
MwoI GCNNNNNNNGC 1 cut(s) 318
NcoI CCATGG 1 cut(s) 21
NdeII GATC 3 cut(s) 199, 343, 444
NlaIII CATG 4 cut(s) 25, 229, 299, 312
NmeAIII GCCGAG 1 cut(s) 194
NmuCI GTSAC 1 cut(s) 40
OliI CACNNNNGTG 1 cut(s) 117
PagI TCATGA 1 cut(s) 225
PkrI GCNGC 3 cut(s) 381, 405, 433
PleI GAGTC 1 cut(s) 260
PpsI GAGTC 1 cut(s) 260
PspPI GGNCC 2 cut(s) 135, 396
PstI CTGCAG 1 cut(s) 381
PsuI RGATCY 2 cut(s) 199, 444
RseI CAYNNNNRTG 2 cut(s) 117, 224
SaqAI TTAA 1 cut(s) 12
SatI GCNGC 3 cut(s) 380, 404, 432
Sau3AI GATC 3 cut(s) 199, 343, 444
Sau96I GGNCC 2 cut(s) 135, 396
SchI GAGTC 1 cut(s) 260
SetI ASST 6 cut(s) 47, 286, 384, 405, 423, 433
SfaNI GCATC 1 cut(s) 443
SfcI CTRYAG 3 cut(s) 279, 377, 438
SinI GGWCC 2 cut(s) 135, 396
SmiMI CAYNNNNRTG 2 cut(s) 117, 224
SmlI CTYRAG 2 cut(s) 369, 407
SmoI CTYRAG 2 cut(s) 369, 407
Sse9I AATT 2 cut(s) 76, 140
SspMI CTAG 2 cut(s) 422, 448
StyI CCWWGG 3 cut(s) 21, 392, 421
TaaI ACNGT 1 cut(s) 119
TaqI TCGA 1 cut(s) 416
TasI AATT 2 cut(s) 76, 140
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 3 cut(s) 97, 137, 319
TseFI GTSAC 1 cut(s) 40
TseI GCWGC 3 cut(s) 379, 403, 431
Tsp45I GTSAC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 214
TspGWI ACGGA 1 cut(s) 247
TspRI CASTG 3 cut(s) 97, 137, 319
VpaK11BI GGWCC 2 cut(s) 135, 396
XapI RAATTY 1 cut(s) 140
XmaJI CCTAGG 1 cut(s) 421
XspI CTAG 2 cut(s) 422, 448
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.