RchiOBHm_Chr3g0480441

Chloroplastic group IIB intron splicing facilitator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0003153
Physical Location & Seq
Reverse (-)
26265248 .. 26265663
416 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44546

Sequence Viewer

Length: 201 bp
ATGATTGTTGGATTAGGTAACCTTGGAAATAAGTACCATGGAACTAGGCACAACGGCATTGTGATGAATACAATTAAGTCAAAGGCACTAGTTGGAATAGGTTCCATTGGAGAGGTACCAATTTTGGTGGTGAAGCCTCAAGCTTACATGAATTATAGTGTGGAAGCAGTGTGTTCTCATCATCTTTGTTTGCTATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0004045 GO:0016787 GO:0016788 GO:0052689 GO:0140098 GO:0140101
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pept_tRNA_hydro

Protein Analysis

66

Amino Acids

7.05

Weight (kDa)

9.14

Isoelectric Point (pI)

19.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pept_tRNA_hydro PF01195 1 - 58 4e-09 Peptidyl-tRNA hydrolase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 115
AccB1I GGYRCC 1 cut(s) 115
AfaI GTAC 2 cut(s) 35, 117
AhlI ACTAGT 1 cut(s) 88
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Asp700I GAANNNNTTC 1 cut(s) 100
Asp718I GGTACC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 142
BanI GGYRCC 1 cut(s) 115
BceAI ACGGC 1 cut(s) 70
BcuI ACTAGT 1 cut(s) 88
BfaI CTAG 2 cut(s) 45, 89
BmiI GGNNCC 2 cut(s) 103, 117
BpuEI CTTGAG 1 cut(s) 123
BsaJI CCNNGG 2 cut(s) 22, 37
BseDI CCNNGG 2 cut(s) 22, 37
BshNI GGYRCC 1 cut(s) 115
Bsp19I CCATGG 1 cut(s) 37
BspLI GGNNCC 2 cut(s) 103, 117
BspT107I GGYRCC 1 cut(s) 115
BssECI CCNNGG 2 cut(s) 22, 37
BssT1I CCWWGG 2 cut(s) 22, 37
BstDSI CCRYGG 1 cut(s) 37
BstEII GGTNACC 1 cut(s) 17
BstPI GGTNACC 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 37
BtsI GCAGTG 1 cut(s) 174
BtsIMutI CAGTG 1 cut(s) 174
Csp6I GTAC 2 cut(s) 34, 116
CspCI CAANNNNNGTGG 2 cut(s) 108, 143
CviAII CATG 2 cut(s) 38, 148
CviJI RGCY 2 cut(s) 136, 143
CviKI_1 RGCY 2 cut(s) 136, 143
CviQI GTAC 2 cut(s) 34, 116
Eco130I CCWWGG 2 cut(s) 22, 37
Eco91I GGTNACC 1 cut(s) 17
EcoO65I GGTNACC 1 cut(s) 17
EcoT14I CCWWGG 2 cut(s) 22, 37
ErhI CCWWGG 2 cut(s) 22, 37
FaeI CATG 2 cut(s) 41, 151
FaiI YATR 3 cut(s) 39, 149, 156
FatI CATG 2 cut(s) 37, 147
FspBI CTAG 2 cut(s) 45, 89
Hin1II CATG 2 cut(s) 41, 151
HindIII AAGCTT 1 cut(s) 141
HphI GGTGA 1 cut(s) 142
Hpy188III TCNNGA 1 cut(s) 198
Hsp92II CATG 2 cut(s) 41, 151
KpnI GGTACC 1 cut(s) 119
MaeI CTAG 2 cut(s) 45, 89
MaeIII GTNAC 1 cut(s) 17
MluCI AATT 3 cut(s) 72, 120, 151
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 2 cut(s) 106, 147
MroXI GAANNNNTTC 1 cut(s) 100
MseI TTAA 1 cut(s) 75
MslI CAYNNNNRTG 1 cut(s) 62
NcoI CCATGG 1 cut(s) 37
NlaIII CATG 2 cut(s) 41, 151
NlaIV GGNNCC 2 cut(s) 103, 117
PdmI GAANNNNTTC 1 cut(s) 100
PspEI GGTNACC 1 cut(s) 17
PspN4I GGNNCC 2 cut(s) 103, 117
RsaI GTAC 2 cut(s) 35, 117
RsaNI GTAC 2 cut(s) 34, 116
RseI CAYNNNNRTG 1 cut(s) 62
SaqAI TTAA 1 cut(s) 75
SetI ASST 5 cut(s) 19, 24, 103, 117, 145
SgeI CNNG 6 cut(s) 35, 50, 57, 101, 152, 160
SmiMI CAYNNNNRTG 1 cut(s) 62
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
SpeI ACTAGT 1 cut(s) 88
Sse9I AATT 3 cut(s) 72, 120, 151
SspMI CTAG 2 cut(s) 45, 89
StyI CCWWGG 2 cut(s) 22, 37
TasI AATT 3 cut(s) 72, 120, 151
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 174
TspDTI ATGAA 2 cut(s) 80, 164
TspRI CASTG 1 cut(s) 174
XmnI GAANNNNTTC 1 cut(s) 100
XspI CTAG 2 cut(s) 45, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.