RchiOBHm_Chr4g0420261

DNA topoisomerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0007552
Physical Location & Seq
Forward (+)
45911201 .. 45913044
1844 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39001

Sequence Viewer

Length: 435 bp
ATGCTGCTTTCACTCTTTGGAGTTTCAGGAAAGCTTGTAAGGCGGATTTCTCCAGAAGATGTTACAATAAATACAGAAAAGGATGCCCTGATTCCAGAATGTCCAATCCCTGGTGAAAGTGACAAGGAGAAATTTGAGAAAGCAAGGAAGTTGAAGGACTACATAGGAGCTATCAGGGCTGCATACACTTGGGATATTACAAGTGAGGATGGTCAAAAGCGGCAGCTAGCAGTGGCTACATATCTCATGGATAAACTTGGTCTGAGGGCTGGAACTGAGAAGGTTGATGAGGATGATGATGAAGCTGATATTGTTAGTTGCCGCAGATTAAAAGTAGAGAATGTAAAAGCAATATCCCCTATCTTGTTAGCGGTAAGGCCATGCTTTACAGGAATTAGACTGAATTTTTTATGGTACTGTGAGTTTACACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Topo_C_assoc Topoisom_I Topoisom_I_N

Protein Analysis

144

Amino Acids

16.27

Weight (kDa)

5.33

Isoelectric Point (pI)

35.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Topoisom_I PF01028 38 - 120 5.4e-23 Eukaryotic DNA topoisomerase I, catalytic core
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 110
AciI CCGC 4 cut(s) 43, 220, 322, 371
AcsI RAATTY 2 cut(s) 131, 403
AfaI GTAC 1 cut(s) 416
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 4 cut(s) 34, 170, 226, 305
AluI AGCT 4 cut(s) 34, 170, 226, 305
AoxI GGCC 1 cut(s) 377
ApeKI GCWGC 3 cut(s) 4, 179, 223
ApoI RAATTY 2 cut(s) 131, 403
AsuHPI GGTGA 1 cut(s) 125
AsuNHI GCTAGC 1 cut(s) 226
BbvI GCAGC 2 cut(s) 166, 235
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 227
BisI GCNGC 5 cut(s) 5, 180, 221, 224, 322
BlsI GCNGC 5 cut(s) 6, 181, 222, 225, 323
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BmsI GCATC 1 cut(s) 73
BmtI GCTAGC 1 cut(s) 230
BpmI CTGGAG 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 110
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 109
BseGI GGATG 3 cut(s) 88, 214, 298
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMII CTCAG 2 cut(s) 254, 267
BseXI GCAGC 2 cut(s) 166, 235
BshFI GGCC 1 cut(s) 379
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 1 cut(s) 379
BspACI CCGC 4 cut(s) 43, 220, 322, 371
BspANI GGCC 1 cut(s) 379
BspCNI CTCAG 2 cut(s) 255, 268
BspOI GCTAGC 1 cut(s) 230
BssECI CCNNGG 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 419
BstC8I GCNNGC 1 cut(s) 228
BstDEI CTNAG 2 cut(s) 263, 276
BstF5I GGATG 3 cut(s) 88, 214, 298
BstMWI GCNNNNNNNGC 2 cut(s) 40, 176
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 2 cut(s) 166, 235
BsuRI GGCC 1 cut(s) 379
BtsCI GGATG 3 cut(s) 88, 214, 298
BtsI GCAGTG 1 cut(s) 237
BtsIMutI CAGTG 1 cut(s) 237
Cac8I GCNNGC 1 cut(s) 228
Csp6I GTAC 1 cut(s) 415
CviAII CATG 2 cut(s) 247, 381
CviJI RGCY 8 cut(s) 34, 170, 179, 226, 236, 269, 305, 379
CviKI_1 RGCY 8 cut(s) 34, 170, 179, 226, 236, 269, 305, 379
CviQI GTAC 1 cut(s) 415
DdeI CTNAG 2 cut(s) 263, 276
EciI GGCGGA 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 109
FaeI CATG 2 cut(s) 250, 384
FaiI YATR 7 cut(s) 164, 184, 241, 248, 382, 412, 433
FatI CATG 2 cut(s) 246, 380
Fnu4HI GCNGC 5 cut(s) 5, 180, 221, 224, 322
FokI GGATG 3 cut(s) 95, 221, 305
Fsp4HI GCNGC 5 cut(s) 5, 180, 221, 224, 322
FspBI CTAG 1 cut(s) 227
GluI GCNGC 5 cut(s) 5, 180, 221, 224, 322
GsuI CTGGAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 379
Hin1II CATG 2 cut(s) 250, 384
HindIII AAGCTT 1 cut(s) 32
HinfI GANTC 1 cut(s) 91
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 426
Hpy188I TCNGA 1 cut(s) 264
Hpy188III TCNNGA 3 cut(s) 27, 53, 95
Hpy8I GTNNAC 1 cut(s) 426
HpyAV CCTTC 2 cut(s) 148, 274
HpyCH4III ACNGT 1 cut(s) 419
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 176
HpyF3I CTNAG 2 cut(s) 263, 276
Hsp92II CATG 2 cut(s) 250, 384
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 9 cut(s) 12, 66, 96, 101, 108, 123, 160, 255, 375
Lsp1109I GCAGC 2 cut(s) 166, 235
LweI GCATC 1 cut(s) 73
MaeI CTAG 1 cut(s) 227
MaeIII GTNAC 2 cut(s) 61, 119
MboII GAAGA 1 cut(s) 68
MluCI AATT 3 cut(s) 131, 393, 403
MnlI CCTC 3 cut(s) 199, 258, 283
MseI TTAA 1 cut(s) 329
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
MwoI GCNNNNNNNGC 2 cut(s) 40, 176
NheI GCTAGC 1 cut(s) 226
NlaIII CATG 2 cut(s) 250, 384
NmuCI GTSAC 1 cut(s) 119
PfeI GAWTC 1 cut(s) 91
PflMI CCANNNNNTGG 1 cut(s) 110
PkrI GCNGC 5 cut(s) 6, 181, 222, 225, 323
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
RsaI GTAC 1 cut(s) 416
RsaNI GTAC 1 cut(s) 415
SaqAI TTAA 1 cut(s) 329
SatI GCNGC 5 cut(s) 5, 180, 221, 224, 322
ScrFI CCNGG 1 cut(s) 111
SetI ASST 5 cut(s) 36, 172, 228, 285, 307
SfaNI GCATC 1 cut(s) 73
Sse9I AATT 3 cut(s) 131, 393, 403
SsiI CCGC 4 cut(s) 43, 220, 322, 371
SspMI CTAG 1 cut(s) 227
StyD4I CCNGG 1 cut(s) 109
TaaI ACNGT 1 cut(s) 419
TasI AATT 3 cut(s) 131, 393, 403
TauI GCSGC 2 cut(s) 223, 324
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 329
Tru9I TTAA 1 cut(s) 329
TscAI CASTG 1 cut(s) 237
TseFI GTSAC 1 cut(s) 119
TseI GCWGC 3 cut(s) 4, 179, 223
Tsp45I GTSAC 1 cut(s) 119
TspDTI ATGAA 1 cut(s) 315
TspRI CASTG 1 cut(s) 237
Van91I CCANNNNNTGG 1 cut(s) 110
XapI RAATTY 2 cut(s) 131, 403
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.