Rh5AG169700

dna topoisomerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0007552
Physical Location & Seq
Reverse (-)
18764253 .. 18779888
15636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG169700.1

Sequence Viewer

Length: 228 bp
ATGGACAAAGATGCAGGCCTGATCCATTTCATTGTCAGTAAAATGCCAGCACACACAAACATAAAGGATAAAGGTAACTATAGCAGTGACGAACTATTTGACAAGTTGGACACCCGTAAATTGAATGCACATTTAAAGGCACTGATATCTGGCCTTACAGCGGAAGTATTGCATGCAGCCGTGCATACAATGTGTCTATCACATTGGAATAATACGTTAGTGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Topo_C_assoc Topoisom_I Topoisom_I_N

Protein Analysis

75

Amino Acids

8.34

Weight (kDa)

7.01

Isoelectric Point (pI)

14.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Topoisom_I PF01028 23 - 57 1.9e-06 Eukaryotic DNA topoisomerase I, catalytic core
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 161
AclWI GGATC 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 1 cut(s) 124
AlwI GGATC 1 cut(s) 16
AoxI GGCC 2 cut(s) 16, 151
ApeKI GCWGC 1 cut(s) 176
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
BbvI GCAGC 1 cut(s) 188
BceAI ACGGC 1 cut(s) 164
BfmI CTRYAG 1 cut(s) 79
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
Bsc4I CCNNNNNNNGG 1 cut(s) 160
BseLI CCNNNNNNNGG 1 cut(s) 160
BseXI GCAGC 1 cut(s) 188
BshFI GGCC 2 cut(s) 18, 153
BslI CCNNNNNNNGG 1 cut(s) 160
BsmI GAATGC 1 cut(s) 130
BsnI GGCC 2 cut(s) 18, 153
Bsp143I GATC 1 cut(s) 21
BspACI CCGC 1 cut(s) 161
BspANI GGCC 2 cut(s) 18, 153
BspPI GGATC 1 cut(s) 16
BssMI GATC 1 cut(s) 21
BstC8I GCNNGC 3 cut(s) 16, 48, 174
BstDEI CTNAG 1 cut(s) 225
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstNSI RCATGY 1 cut(s) 176
BstSFI CTRYAG 1 cut(s) 79
BstV1I GCAGC 1 cut(s) 188
BsuRI GGCC 2 cut(s) 18, 153
BtsI GCAGTG 1 cut(s) 91
BtsIMutI CAGTG 2 cut(s) 91, 140
Cac8I GCNNGC 3 cut(s) 16, 48, 174
CviAII CATG 1 cut(s) 173
CviJI RGCY 3 cut(s) 18, 153, 179
CviKI_1 RGCY 3 cut(s) 18, 153, 179
DdeI CTNAG 1 cut(s) 225
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
DraI TTTAAA 1 cut(s) 135
Eco147I AGGCCT 1 cut(s) 18
Eco32I GATATC 1 cut(s) 147
EcoRV GATATC 1 cut(s) 147
FaeI CATG 1 cut(s) 176
FaiI YATR 4 cut(s) 62, 81, 174, 186
FatI CATG 1 cut(s) 172
Fnu4HI GCNGC 1 cut(s) 177
Fsp4HI GCNGC 1 cut(s) 177
GluI GCNGC 1 cut(s) 177
HaeIII GGCC 2 cut(s) 18, 153
Hin1II CATG 1 cut(s) 176
HpyCH4IV ACGT 1 cut(s) 215
HpyCH4V TGCA 5 cut(s) 14, 128, 172, 176, 184
HpyF3I CTNAG 1 cut(s) 225
HpySE526I ACGT 1 cut(s) 215
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 3 cut(s) 32, 60, 135
Lsp1109I GCAGC 1 cut(s) 188
MaeII ACGT 1 cut(s) 215
MaeIII GTNAC 3 cut(s) 74, 86, 220
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MluCI AATT 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 87
MseI TTAA 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 161
Mva1269I GAATGC 1 cut(s) 130
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 176
NmuCI GTSAC 2 cut(s) 86, 220
NspI RCATGY 1 cut(s) 176
PaeI GCATGC 1 cut(s) 176
PceI AGGCCT 1 cut(s) 18
PctI GAATGC 1 cut(s) 130
PkrI GCNGC 1 cut(s) 178
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 1 cut(s) 21
SetI ASST 2 cut(s) 76, 218
SfcI CTRYAG 1 cut(s) 79
SgeI CNNG 8 cut(s) 27, 31, 59, 115, 126, 162, 185, 193
SphI GCATGC 1 cut(s) 176
Sse9I AATT 1 cut(s) 119
SseBI AGGCCT 1 cut(s) 18
SsiI CCGC 1 cut(s) 161
StuI AGGCCT 1 cut(s) 18
TaiI ACGT 1 cut(s) 218
TasI AATT 1 cut(s) 119
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 2 cut(s) 91, 147
TseFI GTSAC 2 cut(s) 86, 220
TseI GCWGC 1 cut(s) 176
Tsp45I GTSAC 2 cut(s) 86, 220
TspDTI ATGAA 1 cut(s) 19
TspRI CASTG 2 cut(s) 91, 147
XceI RCATGY 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.