Rorug04G0161700

DNA topoisomerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0007552
Physical Location & Seq
Reverse (-)
28136320 .. 28136643
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0161700.1

Sequence Viewer

Length: 285 bp
ATGGCTTTGAAGCAAGTGATCGAAAGTGATTGCCAGGTAGCAGTAGTAGCTCTCACCAGTGAGCAGGTTGATCTCTCTCAAGTCAATGCTTTAATTGCTGAAGTTAAGGACCTGTTAACTCCAAACGCAGGTATTCGTATTCAATTTGTTCCCAGGCAGGCTAATAATGTCGCTCATAGGCTTGCTAGTCATGGTTTTGAGTCTAATGTCAATCATGAGTGGTTTGTAAATACTCCAGAACTTCTCCTGGATGCCCTTATGTACGATCTCAATCGTATTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Topo_C_assoc Topoisom_I Topoisom_I_N

Protein Analysis

94

Amino Acids

10.5

Weight (kDa)

5.11

Isoelectric Point (pI)

27.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 6 - 64 2.1e-08 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 55, 119
AcuI CTGAAG 1 cut(s) 120
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 2 cut(s) 10, 143
AjnI CCWGG 3 cut(s) 33, 152, 246
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 46
AvaII GGWCC 1 cut(s) 109
BciT130I CCWGG 3 cut(s) 35, 154, 248
BfaI CTAG 1 cut(s) 186
BfuAI ACCTGC 2 cut(s) 55, 119
Bme1390I CCNGG 3 cut(s) 35, 154, 248
Bme18I GGWCC 1 cut(s) 109
BmgT120I GGNCC 1 cut(s) 109
BmrFI CCNGG 3 cut(s) 35, 154, 248
BmsI GCATC 1 cut(s) 241
BpmI CTGGAG 1 cut(s) 219
BpuEI CTTGAG 1 cut(s) 63
BsaBI GATNNNNATC 1 cut(s) 270
BsaJI CCNNGG 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 128
Bse1I ACTGG 1 cut(s) 57
Bse8I GATNNNNATC 1 cut(s) 270
BseBI CCWGG 3 cut(s) 35, 154, 248
BseDI CCNNGG 1 cut(s) 152
BseGI GGATG 1 cut(s) 256
BseJI GATNNNNATC 1 cut(s) 270
BseLI CCNNNNNNNGG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 128
Bsp143I GATC 3 cut(s) 18, 70, 265
BspHI TCATGA 1 cut(s) 214
BspMI ACCTGC 2 cut(s) 55, 119
BsrI ACTGG 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 152
BssMI GATC 3 cut(s) 18, 70, 265
Bst2UI CCWGG 3 cut(s) 35, 154, 248
BstC8I GCNNGC 2 cut(s) 159, 183
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 3 cut(s) 21, 73, 268
BstMBI GATC 3 cut(s) 18, 70, 265
BstMWI GCNNNNNNNGC 2 cut(s) 47, 95
BstNI CCWGG 3 cut(s) 35, 154, 248
BstSCI CCNGG 3 cut(s) 33, 152, 246
BtsCI GGATG 1 cut(s) 256
BtsIMutI CAGTG 1 cut(s) 64
BveI ACCTGC 2 cut(s) 55, 119
Cac8I GCNNGC 2 cut(s) 159, 183
CciI TCATGA 1 cut(s) 214
Cfr13I GGNCC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 262
CviAII CATG 2 cut(s) 191, 215
CviJI RGCY 4 cut(s) 5, 50, 161, 181
CviKI_1 RGCY 4 cut(s) 5, 50, 161, 181
CviQI GTAC 1 cut(s) 262
DpnI GATC 3 cut(s) 20, 72, 267
DpnII GATC 3 cut(s) 18, 70, 265
Eco47I GGWCC 1 cut(s) 109
Eco57I CTGAAG 1 cut(s) 120
EcoO109I RGGNCCY 1 cut(s) 109
EcoRII CCWGG 3 cut(s) 33, 152, 246
FaeI CATG 2 cut(s) 194, 218
FaiI YATR 4 cut(s) 177, 192, 216, 260
FatI CATG 2 cut(s) 190, 214
FokI GGATG 1 cut(s) 263
FspBI CTAG 1 cut(s) 186
GsuI CTGGAG 1 cut(s) 219
Hin1II CATG 2 cut(s) 194, 218
HincII GTYRAC 1 cut(s) 117
HindII GTYRAC 1 cut(s) 117
HinfI GANTC 1 cut(s) 200
HpaI GTTAAC 1 cut(s) 117
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 117
Hpy188III TCNNGA 2 cut(s) 215, 236
Hpy8I GTNNAC 1 cut(s) 117
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 95
Hsp92II CATG 2 cut(s) 194, 218
KspAI GTTAAC 1 cut(s) 117
Kzo9I GATC 3 cut(s) 18, 70, 265
LweI GCATC 1 cut(s) 241
MaeI CTAG 1 cut(s) 186
MalI GATC 3 cut(s) 20, 72, 267
MboI GATC 3 cut(s) 18, 70, 265
MluCI AATT 2 cut(s) 93, 143
MlyI GAGTC 1 cut(s) 209
MseI TTAA 4 cut(s) 92, 105, 116, 283
MspR9I CCNGG 3 cut(s) 35, 154, 248
MvaI CCWGG 3 cut(s) 35, 154, 248
MwoI GCNNNNNNNGC 2 cut(s) 47, 95
NdeII GATC 3 cut(s) 18, 70, 265
NlaIII CATG 2 cut(s) 194, 218
PagI TCATGA 1 cut(s) 214
PfoI TCCNGGA 1 cut(s) 246
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
PpuMI RGGWCCY 1 cut(s) 109
Psp5II RGGWCCY 1 cut(s) 109
Psp6I CCWGG 3 cut(s) 33, 152, 246
PspGI CCWGG 3 cut(s) 33, 152, 246
PspPI GGNCC 1 cut(s) 109
PspPPI RGGWCCY 1 cut(s) 109
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SaqAI TTAA 4 cut(s) 92, 105, 116, 283
Sau3AI GATC 3 cut(s) 18, 70, 265
Sau96I GGNCC 1 cut(s) 109
SchI GAGTC 1 cut(s) 209
ScrFI CCNGG 3 cut(s) 35, 154, 248
SetI ASST 5 cut(s) 39, 52, 69, 114, 133
SfaNI GCATC 1 cut(s) 241
SinI GGWCC 1 cut(s) 109
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
Sse9I AATT 2 cut(s) 93, 143
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 3 cut(s) 33, 152, 246
TaqI TCGA 1 cut(s) 21
TasI AATT 2 cut(s) 93, 143
Tru1I TTAA 4 cut(s) 92, 105, 116, 283
Tru9I TTAA 4 cut(s) 92, 105, 116, 283
TscAI CASTG 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 269
TspRI CASTG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 109
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.