RchiOBHm_Chr4g0432341

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
56503638 .. 56504381
744 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40096

Sequence Viewer

Length: 168 bp
ATGACTTGCTTTAAGTTTATTATTGATCAGAATAACTTTTTCAAAGTGGTTCTATGCTTCATCCCCCAAGTTCCTGATGCCATTTCTCTAGAGGACTGTGTTCCTTCCATGTTTCTCAATTATGACGGCTCTACCTTTAGTGGCTATCAGTCGCAATATCAAGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.31

Weight (kDa)

4.05

Isoelectric Point (pI)

27.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 43
BceAI ACGGC 1 cut(s) 142
BclI TGATCA 1 cut(s) 25
BfaI CTAG 1 cut(s) 89
BmsI GCATC 1 cut(s) 67
BseGI GGATG 1 cut(s) 60
Bsp143I GATC 1 cut(s) 25
BssMI GATC 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 98
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 60
CviAII CATG 1 cut(s) 109
CviJI RGCY 3 cut(s) 129, 144, 164
CviKI_1 RGCY 3 cut(s) 129, 144, 164
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
FaeI CATG 1 cut(s) 112
FaiI YATR 3 cut(s) 55, 110, 123
FatI CATG 1 cut(s) 108
FbaI TGATCA 1 cut(s) 25
FokI GGATG 1 cut(s) 47
FspBI CTAG 1 cut(s) 89
Hin1II CATG 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 30
Hpy188III TCNNGA 2 cut(s) 74, 89
HpyAV CCTTC 1 cut(s) 114
HpyCH4III ACNGT 1 cut(s) 98
Hsp92II CATG 1 cut(s) 112
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 1 cut(s) 87
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 89
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MluCI AATT 1 cut(s) 118
MnlI CCTC 1 cut(s) 85
MseI TTAA 1 cut(s) 12
NdeII GATC 1 cut(s) 25
NlaIII CATG 1 cut(s) 112
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 25
SetI ASST 1 cut(s) 137
SfaNI GCATC 1 cut(s) 67
SgeI CNNG 5 cut(s) 18, 80, 86, 101, 121
Sse9I AATT 1 cut(s) 118
SspMI CTAG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 98
TasI AATT 1 cut(s) 118
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 49
XbaI TCTAGA 1 cut(s) 88
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.